Description :
From Genome Similarity Track
Location :
Scaffold_696:166- 2208
Sequence
2042 bases(100 bases per row)
TGCCCAGAAGGACTGGCCCCATGTCACGGTCGTGGACCGGTTGTCCACAATGCAAGCTGAACAGAGAGCGAGCGATGGCCCTCTCTGTATGTCTTGCACA
GCGCTGTTGCGCGAACACTCCTCGCTACGAAGCGAGGTTGTTAACACTTTGGCGGTAGAGCAGGGGCTCCCGCAATCCGAGCAGGCGGTCGAGCATGGGT
TCCCGTCACGCAACGCGGCGGTCAAGCATGGGTTCCCGTCACGCAATACGGCGGTCGAAAATGGGTTCCCGTCACGCAACACGGCGGACGAGCATGGGTT
CCCGCAACACACCAAGGCGGTTGAGCATGGGTTTACGCAAAACACTCAAGCGGTTGAGCCGAGGTTCCCGCAACGCGATTCGGCGGTCGAGCAGTTGGAG
CTCCCGTCATCCACAGCGGTGGTCGAGCAGTTGACACTCCCACCGGCTACGACGGCGATCGAGCACGGGCTCTCGCCGGTCGATGGCGCGGTCGCGCATC
GAGAGCTCCCGCGCACTACCGACACGGTTGATGGTGCCCCTCCGTGTCTAGAGGGGGGTGATCCCTCGTCCAGCGATAGCGAGTCTTCTGTCTCGAGCAG
CGGCTCGAGACGCCGCAAGAAGAAATCCAAGCGACGCCGCCTTAAGCGACGTGGTCAGCCCACCGCCGATATCGCAGTGAATGAGTCCATACACGTCCTG
GAACACGTGGAAGGAGGCGTCGTTCGCTCACGCACACTTGACATTGAGAGCCCACCTCGCGAAGCCTCTTCCATCACACGCCTTCCGGGTCTCTCCTGGA
AGCATTTTCTGCGCGATCTGAAGTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGAGTCTGCCTCGGCGGAAGAGATCCACACGGTCGCTACCGACAA
TCTTCCACTTCGTCCAAAGAACGCTTAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGCCCAGTCGTGGGAGTCACTCCGCGACTCGGGCAATCCAGTA
TACGACACCGTCCGCGAGTTCGCGGATGTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGAGATTGATCTCACGCCGGG
TTCCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGACGACTTCTTCGAGAGCCGCCGCAAAGCGGGTCACGTGCGC
GAGAGTACCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTGTTCACGCTTTTAACAAGCTAAACGACGCCACCA
TTCCAGCACAAACGCCGATCCCTCGGAAGGATATGGTACTTGACACCATAGGCCGCAGTATTATTTTCAGCACCATCGACCTGACCGATGGCTTCTATCA
GATCTTGATGCGACTCAGCGACGTCCCGCTCACAGCGGTGAGCACTCCCAGCGGGATGCTGTGGGAGTGGCTTGTCATGCCGCAGGGCCTGAAAAACGCA
CCAGCCACGTTCAATCGCATGGTTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCGCTGAGT
GCGATCTCAGCGCCACAGAAGCTCACTTAAATCACTCACGACAAGTATTCCAAGTCATGCGCGAAAACAAACTGTACGCGAACTTGAAGAAGTGCATCTT
CTGTGCCCCGGAAATTCCGGTGCTTGGCTGTTATGTGAGCAAAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATTTGTGCGTGGCCCACGCCG
CAGAATCAGACTGAATTGCGTCAGTGGCTTGGCCTCGCAAATTATCTCCACAAGTACACGAAAAATTACGCTGGTCTGATCCAGCCTTTGTCTTCATTGC
TGAAGAAAGACATCACGTGGTCGTGGACTCCCGAACATCAGTCAGCCTTTAATGCAGTGAAGAAAAGCTTGGCGGAGGCCCCAATCCTGGCGCTTCCAGA
TGATGCAAAGCCATTCCACGTTGTTTGGTACGCGAGCGACTT