Description :
From Genome Similarity Track
Location :
Scaffold_2065:166- 1348
Transcript NameFunction/comments
Phyra_87491PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1182 bases(100 bases per row)
CGCGGCTGTCTCCGGTCACCCCAAGCGAACGTCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCG
AGAGGGTCTCGAAGCGTCCGGAGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAG
AAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCTGCACCGGAGATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCA
CGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAACCCACCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGA
CAAGAAGAAACTCGCGGGGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGTGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAG
TGTCTGCCGGGCAGACACAGGAAATGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGA
TAACCCTCCGACGTTAGCGTCGGAGTTGGTGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGC
ATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAAC
GCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTT
ACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCA
ATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCG
GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN