Description :
From Genome Similarity Track
Location :
Scaffold_66:165997- 211500
Transcript NameFunction/comments
Phyra_96172uncharacterized protein
Phyra_96173Cullin-associated NEDD8-dissociated protein, putative
Phyra_96174GJ16370
Phyra_96175Probable ATP-dependent RNA helicase DDX20
Phyra_96177pyridoxamine 5-phosphate oxidase
Phyra_81983Rab11 family GTPase, putative
Phyra_81984threonine synthase
Phyra_96181importin alpha-2 subunit
Phyra_96182DUF3342 domain containing protein
Phyra_71978vacuolar protein sortingassociating protein putative
Phyra_81989PREDICTED: recoverin
Phyra_81990serine/threonine-specific protein kinase NAK, variant
Phyra_71979GMP synthase [glutamine-hydrolyzing], putative
Phyra_71980fumarylacetoacetate (FAA) hydrolase, putative
Phyra_81993ras-related GTP-binding protein, putative
Phyra_81994predicted protein
Phyra_52110malonyl-CoA decarboxylase (MCD), putative

Sequence
45503 bases(100 bases per row)
GTTGTTTCAGCAACACAATCTCCTTGTCCGCCTCCAGTTTCAACGCCACATACAAGTCGCGGAGTTTCTGGAAATGGCAGCACCATTAGTTCCTGTAACG
ACGATCTCTTACAGGTGGAAGTGTGTCGGTGCGATTGCTTACCTAGAGCTCTCGCCTGTTATGTACTTCTCGAAGGCACCGACTCGGAGCCATCCACTCT
TCTCGGGGCCTCCAAGAAGAGTTTTCTTGGCCAATAAGGTGGTTTTTGTCTCCGACTCGGCAACTCATTTCAACCGTTCTTGTTGAGGTTCCTACTCGAG
ATGGTTGTGTCCACGCTGAACGATGGATATGAAAGTGGCACCATGGAGTCAGCATTTTGTCTGCAAAACCTTAGACCTGGAATGACACGATCTTCACGAA
AGGTCGTCTGTCGCCGTTGAAAACACGCCAAGACACCTTCGTCCTCCCCGATGCGCTGGTCTCCACTTGTGCTGCTTGGCCTTCTCTTTGCCATCTTGCA
ATGTCTAGCGTGTTGCCACGCGAAAACGATCGATTATGAAGCGCTGGAAAAATCGTGGGAGGTTGGGGACAATGATGCAGAGCTGCGCACGGAAGGAGCC
GAGCACTATCGGCAGCTTGCAGACAAGTGAGTGTACCATAGCCCACCTTGATACAGCATGCAGCTCCAGCAAAACTCATTTGTTTGCCCTTTTTATCAGG
AGCGAGGACGAAGCGAAGGCTCTCGGTCCTCAAATGATATTCGTAACGATGAAACACGGCGGCGATCAACGACGAGAGCCTCTTCCTGGCGTTGCAGCAC
GATGGAAAGAGGTAAGATTATAAAGCGGTGGCTGCATGCACTAGCGAACTTGTAAGTACTTACATGGTTGGTTTTTGCAGATGCTGTGGAATGGTGGGAT
CGAAGTGAACATCTACGAAGTTGCCGAATCGAAGCTTCTCGTTGGACTACAGAAAGGCATGTTCGTCAACGATGTCATGCGCTTTCTCGACCAGCAGCGA
GACGTGAGAGAGTACGAATGGAACGGCAAAACGTATTCACACAGCACCAAGTCGACCAAGCTTAGCCACCAAAACCACCGTCAGAAGAAAACGAAAAAGG
CTCACCGAAAAAAAGCACACCACCCACAGTCTAAACGCTCAAAACTAGGCCATCACGTGCACATGAACGGAAAACAGCCTCGCCCTAAAACTCCTCAGCC
CGCATTCTCTGAAGACACTGCACAACCCAAGATGACAGAACCTCCCCAGCGTAGCGGGCCAAACGATGAGCTGTGACATTAAGGTCAAATGTTTATCTGA
ACACAAATCCACTCATTTCCACCATGCTCAGCTCTTTGTCTCTTGTGTCGGTTCGGCTTAGTTGCTCGTGCGCTCACTCCGAATAGTTTCAAGCAACGGG
CCCAGCATCTTGTTCTTCTTTGCGTTCTCCATCACGGTGTGCAGTCTCGGGTGGGAATCTGCGTCACGCACAGCGCTGATCGCTTCCAGAGCACGTAACG
CGCTACGAATGAGATCCTTCACGCGCTCAACCTCAGGCCCAACCTGGTCCTCTTTGACCTTCTTGTTGATCGTCTTCTCCAGCGGCTCGACCAAAGAGTC
CAACGCACCCACAATACTACCAGGCTGAACGTAGCAAATCTTGATCAAGATTTGGTGACTAAGCATCTGAACGTCGTCCTGGTCTCCCAGACCGCGCTTC
AGCTGGTCGAAGAACAGCGAAATATCCAGCTGCTGCGGTAGCACCTGGATCAGTGTATCCACACACGAGTACGCAGCCTTACGGAGCGGAAGCCCATCAT
CCACCTTGTGTTTGAACGGACCGAGGTCAACCACTCGCTCCAACTTAGTTTCTGTCGCCTTCAGGAGCACTGAGAAGATGCGCTCACGGACGTACGGCAC
CAGATAGTGCGCGTGGTGGTGAGCCGCCGTGTTTAGCACCAGCAGGGCAGCCCGGCGCACGTGCAAATCTTCGTCTTCAAGCGCCGCCAAGAAAGGGTCG
ATGTGAGCGAAGATCGCGTTGACCGCAGGCTCTTGCGCCGTTGTCGTCATCGCATACTTCAGACTTGTCACGGCGGTCCAACGAGACCATACGTCAGATG
ATCCGCAAAGTTCCGTCACAATGGGCATGATTTTTGTACTGTCCGTCACGGCGAGTTTCCCCATGCATTCGCCAACCATATTGCGCACCCCCTCTTCTTG
ACGAGCACTCATCTTCTGTAAAACTGGCAGCACGCGGTCTACATACAGCGCAAAACCGTGGTGAGGCTTAGCTGCGTGGTCCGAAATGACTTCGCGTAGC
GACGTCAGCAGCAAGTAAGAGTTCTCTCCAATCTCCAACTTAACCATGATAGTGTCCAGGTACTCTTCCATGTTGCCAACGCAGATACTACCGAGAGAGT
ACGCTGCCGCAGCCTTCACTTCCTCGCCCGCATTACTGAAGCACTTTAGAATCGTCTCCTTCACGTCGGTATACCCAGCAAGCTTGATCTTGCGGCCGAA
CTCGCCCAAGCAGTATAGCGCAAGCACTTTGTTCTTTTCGGACTCCGTTTGCGTGATGTCACCTACAAACTTAGCGAATGCCACCTTGCGATTCGTTTCA
GTTGTAGCCACACATGTACCAGCAACACACCGAGCGATGTTAAGCACAGAATGTTTCGATTCTTCCAAAGGTGTCGCCATCAGCGCCTTGAAAAGTTCGG
TGAAGCTGCTGCCCGGAGAGTTCAACTGTGTGAGTTGCGCGAAGAATCCCTTCAGTGCATCCAAAGTAGGCCCCTGGAGCATGGAGCTATGACAGAGCTC
CAGTGCCTTCACTTGAGCATTTTGCAGCAAAGCGTCTGTCGCAGCAACGTGCGGACACACGCGGAGAGAGTTTGACACCAGCGTAATGCTCATGCGGCAC
AATTGAAGGTCCACGTCGACAAGAAGGAGCGAAGCTTCTTGGACAACTTCGTAGTGCAGAGACTCCGGCATGCTAGCTCCCTTGCGCACAACCAGATCAT
TTAGGGTAGCCAGTGTCGCTTGCTTCAACGTGCGAGACTGCTGGCGAAGCAGCTGGGCCAGAGTTTGTGTGCACTCCACCAGAATAGGGGACATATCCAA
ATCGAGCTTGGAGCGAGCAATGACTCCGATGGCCTTGATAGTCTGCACTCGCGTGATTTCGTTGTTGAGACGCTCCATGAGAAGCGGATAAATTTCGCCC
ACCCGGGGACCAAGTTCGTCACCTACAATCATACCAGCAAAATGTTAGCAGGGAACACTTCGCTTCGTGAATAAAGTTGTCGACAACGTACCGAGGACAG
CAACGATCTCCCCAATACTGCTGATGGCAGCCTCCTTAATCTCTTGATCGATATCATGAACCTTCAAGCTAGGCAACACCGCTTCGAAAAAAGGCACAGC
GTACGGCTTGTACGCCATGTCTCCATCGTCAACCCGAATAATGCGGACTAGAGACTCAATCAACCCCAGCGCCTTTGCCACCGTTTTGTACCAGTCTCCC
CTCGCGCATTGCACTGCAACGTTGATGACCGAATCAATATGCGGTCGGAATGGTTCCACCGTGTGCGTATCCACGAGCAGTCGGAGAAACAGAAGTGAAT
CCAGCTTTAAGTCCGAGTGCTTGTCCTCCACTGCGTTTAAAATATTCGGCATCAAACGTCCAATGTAGTCTCCCAACTTTCCGTGCTCCACCATGGCGAG
TTCGCTAAGCATCGCAACTACAGCACATCGCGACGGAACTGAAGACTTCGTTCCAAACTGCTTGTTGGCTCCAGCCACGATCGTGTTAAGGCGCTGCTCC
AACTGCGTAACGCATCCGTTCGACTTAGGTGGGTGAAAGGAACCAGCTCCATTTGAGCTTGGAAGTGTCTTGTGAGTCGCACGAAGAAGCTCTGCAAATA
CGCCAAACACGTCGATCCGAACGTTTTCTTCTCGCTCTTTGAAGCGCGAAATAAGGGGCTGGGCACAGTGGATGTAGAGATGTTCCAAAAGCTCTGATCT
CGTTGTGATGATAGCAGTCAAAACACGAAGACTGGCACGACGGACCTTCCAGCTGGTGTCGTCATCGTCACTGTAGTCGCCTTCCTCATCACTGTATTCC
TCCTCTTCCTCTTCCATGTCTTCATCTTCGTCGGCCGAGTCGACATAGTTGTAGTTGGGGTCGTACGAAATAAATTGCAGCACAAGCTTCAGAATAGCTT
CAACGTGAGGCGTGATCTCGTTATGGCATCGAACGATAAATGCTTCAAACGCCTGGAAGCAGTTGCCTCGAAGCTCATCTGAGTCTTCGTTTTGCAATGA
CTCGTCCTCAGGGTCTCCGCAGAACTGAACCAAGATCTGGATCACGGCGTCCAAGTGCCGCCCAAGACGGTGGCCTGCAGTGCGCGAGAGCATTCCGATC
GTCTGGATCAACGTGCGCACATTCGCCGAGTCGGTTGAGCCCTGAATGCCCTTGATCAGGTGCTCTACCAGACGGCTCACCAGCACGTCAGACGCCATGA
CACCCAGCGACCCCACACAAGCCGTGGCCCGCTTGCGCACCAGCGGCGATTCGTCAGTCAGCTGCACCATCAGCAGCTCCATAATCGTCGCGTGCTCCGT
TGCGACGTCGTAGCCAAATCGACGCAGCAGGTCCGTGAGGATGTCAAGCGTCTCGGTCTTGACAGCCGCGTCCTTGTCCTTGCCCAGCCCCGTGAACAGA
CGCGTGCAGATGCTCGTGGCAACAGACGCTCCCGTCGTCTGGGACACGTCCGCGACGATGGTCTTGAGTCCAATCGAGTAGATATCCCGTAGCTCCGGCT
TGCCGTTGAGAATGAGGTCGCAGAGCTTGGCGCAAATGTCGGCCACCTGCGCTACCTGCACTTTGGTCACCAGGACGCCCAAGCACTTGACGGCGATGGA
CTGCACGTCGTTCGACTTGTCGTCCAGTTGCTTCAGCACCGCTGCACACACTCTGTAGTGCCACCATGCACACATTTAGCCCCTTTCCTCAACTAGAAGA
ACTACAAGCGCCTTACTTTGGCTCGAGATACGGCCCCAGCTCCACGTCCTTGTTGAGCTCGCTGCACAGATCAGAAGTGGCCATGTAGCGCTCATCCTTG
TCAAAGTCCGTGGTCTGCAGCACACACACATACATCAGCACCAGACCCCACTGGCTACACGGAGTGAGACGCAGCGCACCTTGTCCAGCAGCTGCGCGAT
CTTGTCCTCGTTCGCGCGCATGTTTCTCCTCCTCCAAACGTGAAAGCGAGTGATTTCGAAGGATCTCGGGATGATCATGTGCACCACATCAACGACCATC
ACTCTGGAACCGTTACTTCAACGTTGGCTCGCATTCGCGTTTAAGCAAGCGACGCCCATGAGTGCGACGCGCTGCTAGTTGCTTGCCGTATATACGTCGA
TAAGCTAACATGTCTGCTGTGAGTGTGCGCAGGCGAGAGCGACAGCACCGTGGTGCCTGACCAGCTTGCGTCCCTCATTTCGGATGAAGTGGAGCGCCAG
CTGAGAGAGCGCGGCTCCGTGCTCGAGGCCATGAAGGAGCAGATGGCCAAGGTGCTGGCCGAGTTCGAGGAGATGGCGGTCAATGTTAGCTCCAAGCGCT
CGTGGTCCAACAGCGTCGCGAGGACGAAGCCCTTCGCCTCGCCCAAGAAGGCGCTCTTCGACATCCACCCGGTCGTCACGCCCCTGGATATCGTCCCTTC
TTCACCTCCAAAGCTGCCCAAGTAGGAGCAGTGCAAACTGCAGAGTGGAATGGATGTGCGTCTCACCTGGGTGTGTATACTTTTGCGCAGGATTAGCGGC
GGCCTGCTCAAAAACATTCATCAGCTTAAGCACAACGCTAGTGGTGGTGCCCTACCGCCAGGCGGAGCTCGTAGTCCCGACGGCAAGATCACGTTCGGTA
AGCGCTCATACTACAGTGTAAGGAGCGTGTCCTGGATGGTATATTTTAACTACGTTGTTGACCTCTAGACAAAATACTTCCTCGAGTTGCTCACATTGAA
AAACGCACTGACGGTGCACAGATGATGTTATCGCAGCAGAGACAGCAGATGTACGAACGAGCTCTGGTACGATATCCGCAATGCCGAAGCAACGTTTTTG
CTCCCAGCATGTATGATCACGAAGAAGTGTCCAACTTGGATGCAGGCTCAGCACCTCAGGCACCCCGAGCGTCACTAGAGCTTGATTTCGTATATGGATG
CCGAAGTGGAGCCACGACGTCGCTTTCCAGCAGCCATCCTGCAGCAGCACCTAACACTAGTACCAACAACAGCGCTTTCTACCTGTCAACTGGTGAAATT
ATGTGGTTCGCAGCGACGTTAGTGATTCTTTACAGGAAAGAAGCCAATACCCAGAGGTATTTCCGGGAGCACACGAACGAGGTGACGAGTATAGCAGTTC
ACCAGAACCAGCGCATTGTAGCATCCGGCCAAGCAGGACGATCGGCGTTTCTCTTGGTATGGAATGCGAACGATGAACCGCTGGGCAAACGGTTTGCGTG
CCTCAAGGGCCACCAAGTGGCAGTGCGCTCCATCAGTTTTTCTCATGACGGTAAATTGATCGCTTCGTTGGGTGGAGATATGTACAACACCATTTGCATC
CACGACTGGAAGGCGCAAGAGTTATTGGTAAGTGCTCGGGGGCACACGTTTCGGGTTCATGCGGTTGCATTTAATCCTTTTCAGGCATACGGTCGGCCAG
AAACTCAGCGATCAAAGAAACCTGGCCAAGCTTTGCACGATGACGATGCATGCTACACCCTAGCAAGCTGCGGCGTCCGGCATATTCGCTTTTGGACACT
GACAAAGTGCGTGCCCCCTCCATCAAAGGAAAATGTCGACAGTGCATTTTCACGCTCTACATTTGGTGGTCCTCCAAGATTGCGTCCTCCAACACCGACT
GAGAAGGTCTGGAAGCTGGAAGGCAATGTTCCATCGTTCCATGGTCGATTTGAGGTTCAGGACTTTACAAGTTTAACGTTTGTGAACGATTCACCACCTC
TGTATATGTATGATGAACACTCCAAGGAGTTGACGGCCACAAACGCTACTGATCATTCGCTGGGTCGGATCGTAGCTGGCACGGCTAACGGAGATCTGTG
TCTGTTCTTGCAGCCAAGGGCAAGCCCCAATATTGATTTCGTTTCCGAGGGTGATCTTCACAAAGAGCCTGCAAAATGGTGGGAAGTTCCAGACGAATAC
ACTGATGCTGAGATCAACGAACTCGTATTAGAGAAAATCGCATACGAACCAACAGCGAGACTCATTGATATCGTGCCTCATGACCAAGAAACTGGTAATC
GATTTAAACTACCTAAACAAGCTCAAGCGGAGATGCAGAGTTTATCCAAGAAAATGGCGTTGAGGCCCAACTCAACGGCCTTGTTCTCACGGCTGGGTGA
ACTAAAGTATAGCGGTCCGTTAGCTCACCAAGGAGCAGCTTACCAGGTGGCGTACTCCAAGAAACGCAATACGATTATTTCATGCGGAAATGAAGGCAAA
TTGCTGCTGTGGAAGTGTGAAATGAGTAAGCCGCTACGAATCCCTGGAGTTAATACGTTAGGAGTCTTCACACCACTGACTGGAACATTTACAGAGGGGT
CTCACGCGCTACTTCCACTCGATGAAAAGGTATTCTACTTCCCAACTATACTACCACATGAAGCGAGTGCGGGTAGCGCTGCTGCTGCACCCAAGCCCAC
AAGTATTGTATGGAAAGATGACGGGAACTTCGTGCTTGTTGCCACAAGCAATAGCTGCGTTTGGGAACTAAATGTCGAGTCCGGGGATTGGCAACTACTG
TTTGAAGCTCGCAGTGGAGCTGTGACAGCTTGTGCTGCACATCCAACTATGCAGGAAGTGGGGACTGTATCCCAAGACGGATATCTTAGCATCTGGGACC
TCCGACAGCACGTGTGCATTCGCCGCCTGTATCTTGGGAGCTTCATCACCGCTAGTGTCAAAGCCTTTTGTATGGAATTCCATCCAGCTGGAAGCGAAAT
CGCAATCGGGCTCAGCTCAGGCGAGCTACTTGTTGTCGACTATGATTCATTCAAGGTGTTGCTCCGGAAGAATATCAAGTCGAACTCCGGCAGCACTGCC
AATTTACGTCTCTCCGGTCCCGCGTTTCGAGCAATTGCTCAGGTGAAATACTGTCCAAATGCAAAGTTCTTGGCAGTGGGTGTAAAGGACACTTTCGTTT
ACATTTATGATATTGTGAACGGGTACAAGAAACTTCACATTTGCGAGGGCCACTCAAGCGCTGTGATGCAATTAACTTGGAACAAGGATGGCGATATCCT
GCAAAGCAATGCCACCGATGGTGAGATTCTCCACTGGATAGTATCTCCTGTTAAGGGTGAAACCAAACAGATTACTGATGCGTTTCTCGTCCGCGACGTT
CAATGGATTAAATGGACCTGCGTGTTCGGGTGGCCTACGCCTGGCATTTGGTCCGAGGAGTCACCCAACCTTGTAGACATTGCAGCAGTCTCCACTACAG
GCCCAAGGACTGCTAATGAGTACGATGAATGTGGAAACGCTCACACCACCTCCAACGAGGACTTGCTGGCAGTAGCGTGTCGATCCAGTATTCATCTTTT
GAAGTACCCCGCTCATCGTGGTGCCAAACGAAAGGTGTACAAGGCTCATTCGTCCGCTATTTCAGCATTGGGATTTTCATTTGATGATGCATATTTGGTT
ACTGTTGGTGGAGATGATGGAACTCTCATGCAGTGGAGCGTTGTGTTCGATACAACAAGCTCCAGCCCTGCTGGTGTTAAAGTACCAGGTAGCACTGAAA
AAGATAAATCCCGGACACCATTTGCAGAAGATGATAGCACTGGAGAGCAGTGGTCAAGTTCGAGTCCTGCCCCTCCCCCGCAGGATGGCAAGCAACGATC
AAATCAATTGTCTCCTCGAAAACATTCTCGGCAGTACCGCGAACGCCTAGTTTATCAGGACGATAGTAGCCGAGAACCTGAACCAGTCGGTGAAAGCTTG
CATCGACATCCGAGTGAAGAAGAGCCGATAAGCGATATCCGCAGCGACAATTCTAACGAGGACAGGAGTTCTCAAGCAGGTGCCAGTGGTCCACCGGTAG
AGCGAGGTGTCAGCTATCGAGGTAGTACCGATCTCGACGAGCCCCGTCCTGCACCTGTCCAAGTTCGAGCAACACACGACTACGCAGCTGAAAGCCCTGA
CGAGCTTAATCTCAACCGTGGCGAGATTCTGCGCGTGCTCTCAAAAGCTGGTAGCGATTGGTGGCTGGGCGAGACTTGTGATGGTACCAAGGGCTATTTC
CCCGCTAGTTTTGTAGAAGACGTGGACCTTAGCGCTCCCGTCTCCGGCGACGAATCCGTACCAAACGAGGATCCGCCAGCAGAAGGGTAACTGTGTTAAT
TAAGTTTACATTTGCTTCTGTTGCTTTGAAGTTGTGTCATTTGCTGCTGTTGAAGTTGTCTGCGACGTGTGACGCAAGATGGCTACAGTTTCGGTGGCTC
TAGTTGGCCATTTGCTCTCATGGCGACACCGCCGTCGGACACGGCGCTGGGTGCCACCTCGACGACGTTCAGAGACCTGCCGCTGCACGAAGATGTTGCT
CATGCGCTGACGGCCATGCGCTTCCTGCGCCCGTCGCCGATCCAGCTGCATGCACTGCCCGTGGCTCTGTTCGGCAACGATGTCATCGGCCAGGCCAAGT
CGGGCACTGGCAAGACTGCGGTCTTCGGAGTCACCGCCATAGAGCATTCGATTCGTTATGTGGAGCAGCGCGGTCAGCAGACAGAAGAGCTGATGGTGGG
ACATCCATTAGCGCTCGTTCTAGCGCCCACGCGAGAGATTGCAGTCCAGATCGAGAGTGTACTCCGTCAATTGGCGCAGTTCCGACCGAAGCTCGTCATT
CGTACGTGCATCGGCGGTCTACCAGTGGCGCAGGACCAGGTAGCGGAAGCAATACATACGCATTCAACCGGTAGAAGATTGAATGGAGCTGGTATTTGAT
GTTTGCAGATGCACCTGGCGGCGGGCTGTCACATTGTTGTGGGCACGCCTGGGCGCGTGAAGGCGCTTGTGGATCAGTGCTCACTGCCGTGTAGTGCAAT
TCGACTGCTGGTACTGGACGAGGTGGATAAACTCATGGCGCGAGACTTTGAGAAAGATGTACGACTGAATGGATGACATTGGTTACTTAGCTAGGGACTG
ATTGCCGTCATTTCGATGCGTGTACAGATCCAGTATATCGCGGACGCTCTCCCTGAAAGACGACAAGTAACACACTGTCTCTGTGACGAAAGCTACATGT
GATAGTTACGTTGCTACTTTGATTTTGTGGATTGCAGACCCTCGCATTTTCTGCCACGTTCACACCCGACCAGTTGATAGCTGTGACCCAACTAATGAGG
ACACCACAGGTATGTTGGAAGGAACTATATCATGAATTACCCAGTTCTCTATATACCTGATGATACTTTCTCGCTTAGATTGTGCGCGTTCGAGGCCCGG
GTGATGTAACAACCGAGTTCATTTCTTCCGCTGAAGATCTTTCAAACTGGAAGGACCGAGAGCAGTCAAACGCGCCTGAACTCTGGCTTCACCATGTGCG
ACAGTTCTATAGCGTCGTCAAGTCCGCGCCTGCATCAGCCATGGGAGATGATGTATTGAATATGAAGGCGAAGGTAGTCAAGTTGGCAGCGCTGCTGTCA
GAAATCGTATTTGTGCAGTGTATGGTGTTCTGCAACGACAAATTTCGCGCGGAGGCACTAGCCACAGCTCTTACAGCGCTAGGCTGGCCAGCAGCATGTA
TCACTGGAGCTCAAGCTCAAGCTACCCGCCTGGAGGTGATGGAAGACTTTCGCGCATCCCGCTCGCGTGTGTTGGTAACAACCGACCTCACCGCGCGAGG
TATTGACGTCGACAATGTCAACTTTGTGGTACGTTGTGTGGAAAGCGATATATAGGCGTGTTCAATTCCTTATCTATGAACTGGTAGGTGAATCTGGATC
TGCCACGTGACCCAGCGACGTACTTGCATCGCGTTGGAAGGACTGGTCGCTTTGGCGGGAAAATATCCTTTTCATCATGTCTCCTGCATTGATACGGTTG
AGTTTGCCGGACCTCACTGATTCCTTAACCAAGAATTCTCTTTTGTGGTTGTTGTGCGTGCTTACGGTTTAGCAGTGACGCTGCTCTCTAGCAATGAAGT
GCAAGGAGTCCATCTGCTTGCTCGAGTATTCAAGATGAAGATCAGCGAATTGCCAAGTCCAATACCCCGGGAGATCTACTCATACGCAACTGAAGAGGAA
AATGATGACTGCAGTGGCGAAGGAAATGAAGACCCTTCAAAATCTGCGGTGACAGGAAAATTGCAGAAGGAAGATCGTACCGCATCCCATGAACATGAAA
ATGACGAGGAGAATGCCTCCCCGACTGCAGAACAGGTCGTCGAGGATAAACCGTTGTCGAGAGAGACCTCAAGTCGTTATGAGAGGGAGGAAGGCTCGTA
TGAGAGCTGGGTGAAGTTGCTGTAGCCGAGCACGGCGCTTACTTTCTGGATCTACGAAATAAATGGCACAATTTTGACATACAAGTAGTTGATTGATGTC
AAATATGGGGATCTCGTGCACCGAAAAACTAGCCGAACTTCTTTACGATGCGACGCAAGGTGTTGACGGTCCGAACCGTGACTGGAACACCGAGTTTCTT
GTCGAAGGCCACTTTGAACAAAGGGGACTCGCTCATTTTGGTGGTGGAGTACCAGACAAACGCTTTGTCGAGCAGTTGAAGCTCGTCAGCTGCCGTGGAG
AGAGACTCGACGATGCCTCTCTGCTCCTGAGTCAGCTCTTCTTTCACAAGCACCACATTGACCGCTGTCGCCACCTTCACAACCTGATCACCTAGTCGTG
CGACATCGTCCATGGAGCGAGCGAGCACTGGAATGTGGCACCCGAAGAGCCCTTCGAGCGCGTCCTCGACTTGGTGTTCGATGGCAGACACCGAAGACTT
GTTTTCTCCGGCGGGTGGGTCGAAGATGACGTTCCCGCTGGCCAGGAACGTCTCGACGTTGCCGAATCCTGCCTTGCTCAATGCGTCGGCAATCGACTTC
ATGCTGTGCACGCGGCCTCCGACGTTCACGCCTCGAAGGAACGCCACGATCTTCCTGGTGGTGTTAGTCGCCGACGTAGTGTCATCGGATGCATGCGCTG
GTGGGCGTGTGTCCTCAATTGTGGTGGGTTCGGCAGCAGCAGCAGTAGCAGTAGCAGTAGCAGCAGTACTAGCGCGCGTGACTCGCTTGACTTTGGCTGG
GCTCTCCGTCCCAGCAGATGGAGCCTTCCTCTTGCCGGCCATCGCAGCGGCGACTCTCCAGCGAAGGTGAGAACGGGCTACTGAGATCCATCACAAGCCA
TGCCTCTGCCAGGAATGACACGCTCGAGTACCAAAGCGCAGCCATTCGGGCGAATCCTCACTTGTGCAACTTGCAAGATGCGGTCTCTCTTCGTCCACAT
CTGTCCACCATATGCAGCCTGCATAATCCTATTTAAGTCAAACATATAAGGTATCATCGTCAAACTATACATTTGTAAGAGTATCTATATCACCCTCTCT
ATTGCTCGCCCGTCTACTGCAATCCCTGTCTAATAAAGCGCGTTGTTCCGCCCTTCTTCGCAGGCGGCGTATAACCGACTCTTCCTCGCGGTTCTCGCGC
TTCAAGCGTCTCTCTCTCTGCCGAGGCGTCGCCCCCTCCGCCTTCGCTGCCACATCAGATCTTGCCTAGTCATGACCACAGGCGTCGAGCCGTCGTCGTC
CGCGACCGCGTCGTCCACGTCCTCCTCCGTGACGGACAACAACGCGTCTCTGCAGCAGTATATCTCGGCCAAGGAGGTGGCGCAGCACCAGGTCTTCCGT
CAGCACGACTTGCGGCGCTCCATCAGCTCCACGCAGTTCAGCGGTGCCTCCAGCCCGGCGGCCAACGGCTCCAAGGCCTCGGCCGCCGGGTCTTCCATGT
CGGCCTCCAGCAGCCCGCGCTGCTCGTCGCCGAACTCTTTACCCGTCGCCGAGTCCATCCTCAAGGTGGTGCTCATCGGCGACTCTGGCGTGGGCAAGTC
CAACCTCGTCACGCGCTTCACCAAGAACAAGTATATGCCACACAGTGTACAGACCGTGGGCTTCGAGTTCGCGACCAAGACCATTCGCGTCGGGGACCGA
CGACTCAAGGCCCAGATCTGGGACACTGCAGGACAGGAGCGATTCCAGTCGCTCACTGCCGCCTACTACCGCAACGCGGTGGGCGCCATGATCGTGTACG
ACATCACGAACCGAAGTTCGTTCGAACACGTCACGGGGTGGCTCGCCCAGGTGCACGAGCACTCGCACGAGAGTCTCGTGCTCATTCTCGTCGGGAACAA
GTGCGATCTGGCGCACCTGCCGGAGAGCAGAGAGGTGTCGACGCTCGAAGCGGCGAGATTCGCTGCGAAGCATTCGATGGAGTTCCTCGAGACGTCTGCA
CTAGACTCGACGAACGTCGTTGACGCCTTCAAGAAATTGATTGTGCCCGTGGGGCGCCTGCTGTCGCCAACCGAGCCAAAGAAAATCGCGCGACTGCCGA
CAGGGTGGCGGCGCGTGCTCTCAAGAACCAGGCCTGGCGAATACTCGTACGAGAACCAGTACACCAAGGAGCGGATCTCGTTCGCACCTAAAGAACCGGC
GAAGCCGTCGCAGCAGAGCTTCCGAGCGTCGAACGGGTTAAAGAGTGGGTCACCGAGTGTTGTCACCGTCACACGCGAGAGCCTCCAGAGGCAGCATCAA
AAGGCGTATCTCGCACAGAATCAGACACCCCAGTGCGGCGTCTGTGCAAGCAACTGCACTATATTGTAGTCATCGGACCGATGATGCACGGCTTGCCTCC
AGGTCATCAGCCCACAGGCAAACCGTCCTCTTTTTCTCCACCAAGCCAATACAAGTCAATTACAGTCTGCGTGCTGACCCAGGAACGTCGCAAGAATGCG
AATGGAGGGTACAGGGTCGAATAGAAGCAGGCTCACTCATTGGAGATGTATTTTCTTCAGTATAAGGCTTCGCGTTGCTGCGTGCAGCCGATCGCTGTGG
GTGTTGGTTAGCCGCCAGTTTTGTGCCTGCTATCCTTTCATAATGCTGCCGCACACATCTGGCAATATTAAGTTTACAAACATGATGGACATGGTTGGTT
GGTCTCTATGAATGTTCCCACCAGATAATGCTGCTACTAACCACGCACTGCTCATCGCTCGCTATTGCATCATCCTACTGTTTACTTCGAGCGCCGCGCC
ACGAAGAACGCAGCGGCGACGGTCGCAGCAGCGAGCGCGAGAGTGGCGAGCTTGCACTCAGTCGGAGCCGACGTCCACAGCCAGGCACACTCACTGGAAG
CCTTCTGGTTCTTCTTGGCAATAATCTTACGAACGTGCTCGGCCACAGTAGCGCTCGAGTTGCTGGCGACCGATAGCCGTGTAGGAAGCGACTCCAGTGA
CTTGAGAATTGGGTGCTGCTGGATCTCCGCCTCAGCCACACCAAGCGCCTTGGACACCACCGGAAGGAATTTGCCGTAGTGAGCAGTGCCAACGACGACA
ACCGCCGAGTCGGGCTTGTCGGCTAGCGCTTCCTGGCCGTAGTGCATGGCAGAGGCCGCACCAATGGCGCTGTGCGGGTCGAAGAGGTAGCGGTGCACTT
TCTTGTACTCGGCGATGGTGGAGCGGACTTCGTCTTGGAGCACCGCGTACGACGCCATCTCGTTCTGCGCCTTGGTGAGCAGCTCACCCGAGATCGTGAG
CTCGCTGGTCTGCTCGAAACCCTGCATCCAGCCACGCAGCACGTCGTGGTTCTCACCGGACAGCGCGAAGAGGTAGCGCTCGAAGTTGCTGGAGACGCAA
ATGTCCATAGAAGGCGAGATCGTGTGCTCGATGTTGCGGCGGTGGTACTTGCCCGTGGAGAAGAAGCGGTGCAGGATGTCGTTCTCGTTGGTGGCCACAA
TCAGCTTGCCAATCGGCAAACCGAGCTTTTTTGCATAGAATCCGGCAAGGATGTCCCCAAAGTTGCCCGTGGGCACCGAGAACGCGACCTCGCCCGTCAC
GCCCTGCTCGCGAGCACGGAAGTAGGCCCAGACGTAGTACACAATCTGAGCCAGGATGCGCGCAAAGTTGATGGAGTTGACGGCGCCCAGATGGTACTTG
GCCTTGAAATCGGCGTTGGCGAATAGATCCTTGACGATCGCCTGGCAATCGTCGAACGTGCCCTTGACAGCCACGTTGTGGATGTTCTCGTCCAGCACCG
TGGTCATCTGGCGCTGCTGGATAGCGCTCACGCGTCCTTCCGGGAACAGGATAAACACCTCCACATTCTCCTTGCCGCGCAAGCCGTAGATGGCCGAGCT
GCCGGTGTCGCCGGACGTGGCACCAACGACCGTGATCTGGTGCTTGGGGGCGCCCGCGGGCAGCGCCTTGTTCTTGCGCTGCAAAAAGAACTCGAAGAGG
TTGCCCAGGAACTGCAGCGCGATGTCCTTGAAGGCGAACGTGGGACCGTGGAAGAGCTCGAGCACCAACAGCTGGTCTGTCACCTTGACCACGGGCGCCA
CGTCCTCGGCGCGGAACGTGGTCGCGTTGTAGCTCTTGGCCACGAGCGAGCGAAGCTGGGCGCGCGAGATCTCGCTCTCGTTGATGAAGAGGCCCATGAC
CTCCACGGCCAGCTCCTGATAGGAGAGCGACGCCCACTTGGTCAGCGCGTCGGCCGGCAGCGTCGGGAATTCGTCGGCCTCGGGCACCAGCAGGCCGCGG
TCGGCCGCCAGACCCGTGAGCACCGCCTGCTCAAAGCTGAGACCGCGGACGCCGCCGCGCGTGCTGCGGTAGTGCACCATTGTGTGTTGGGTTGGGTTGG
GTTGGGTTAGTGAGAGTAACGCGGCGAGAGCGCAAGTGACGCAGATGAAGCCGCCTGCTTGGGCTCGGGAAACTTCTTGTGCACTGGAGGACGCAGGGCC
CCGAAGTTTCGGGTAACATTTACCGTTGTTGCGCAAACATGCGACGTGGCGCAGATGTTGCACGAGGTGTGGTGCACACCACTTACGGCAATGCTCATGA
ATTTATAGCTCAAGTTATTGCTGACCGCTACCGATTTACGTGTCTTGCTTGATCTGCCATTTGACAAGGAAGGTATGAATACCATGGACACCTGCATTGC
CTAATCGTGTCGGTTCGTCGGCTTCGCTCTCCAAGACATGCAGAAAAGAAGCCGGCACATCTTCAACGAGAAACCGGGAGAGCAACAGCCTGCTGGATAA
TAAAAAAGCAAACAGGGAAATATATTTCGCATGAGTACTATCTCCCCGGGGTGTTCCACAGACTTCTCCTGCCGAGAGCTTTCTTTTCGTCCGCTACCTC
ATTGGAATCCGCCTTCCGTTACTCTCTACCTCATCGCTCGTGATCGCAATCAGTTCTGGCCAAACTGGAACATGGTGGGCTCGTTAGAGGACGTGCCGAA
CTGGAACTGCTGTGCGTTAGCATCCGTGTCGGGCGCTAGGCTATCCTCCGCATCCTCCTCGCCGTTGAAGAATGTTTCCACGATCTTCATAGACTTCAGG
TAAATGTCTGTCATCGGCACGCAAAGCAGTTAGTAAGCATGCAAGGCCGGACGACACAAGGTAATAAATTACCTTCGTTGGCGTGGTACTGCAGCGCCTG
AATCTTGTTCACACCGTCCGCCTCATCAATCATCGTTGCGATGTCGTTAACGTCGTTGGTCTTCTGCGCCTCGCCCGCACGCAGAATGTTCTCAAGACCC
TCCAGGGCCACAATCACGACCTTCGCGTCCTTCACTTCGAGCAGGTCGCACAGAGGCTTGATGCATCCTGTACAAATCGACGACACAAGGTACTGTTAGG
TACAGCAACCCAACTGCAAGTGTTCATTTCACTTACCGAGGCTGACGAGGTGCATGATCTGCTCCGCCGAACCTCCCGAAGTGGCGTTCGACACGGCCCA
CGCTGCCTCCTTACGAATGTCGAACTCAGCCGTTGACAGGAAGTTGATCAGGGACGGGAAAATGTCGGCCTCGATGATGAACTGAATCTGCTCCTGGTTG
CCAGCCGTAATGTTGGAAAGCGTCCAACACGCCTCCTTTCGGATTCCCTTCTTGGGGCTCTCCAGAAGCGCACGCAGACACGGCAGCGCGTTCAGGTTAA
TAATCACCTGCGTCTGCAGATCGTCGCCCGTGACGATATTGCCGACCGTACGCAGAGCAGGCGTCTGCACAGAAGGAGAGTGGTGCATCAGAAGCTCCAC
AATTCGCCGGCACACGCCAGCCTCAATCACCGCCTGAATCTTCTCGTTCGAGCCGTCGGACAGGTACGACAGAGCCCAGCAAGCGTCCGTTAGCACTTCC
TCGTCGTGGGTGTAGATGAGCTGGCCCAGAGTCGGGAGCGCAGGCGACACGAGATCGAACTGCGGCTGCGGTTTGCCACGGCAGAAGTTCGACAGCGTCC
ACGTAGCGTTGCGGAGCATCGTCGGCTTCGAGTTCTCCCTGAGCTGCTGCATGAGCGGACGCAGCGCACCGCAACGCAGCACCATGTCACGGCACTCGAT
GGAGTCACCGGCGATGTTACCAAGGGCCCACACGGCCTGCTCACGCACATCATCGTTCGTGGACAGCAGCAGCTGGCAGAAAATAGGCACCGCGCCGTGG
TTGATCACCACCTCAGTATCCGCAGAGGTACCCGAAGCAATGTTCGTCAAAGCCCAGGCCGCCTCGAACTGCAGGGTTGGGAAGTCCTCGCGCTGAAGGA
ACTGCACAAAAATGGGGACGACGCCAGTGTCGATCACCTCCTTAATAGGCGGGTTGCGCTCTGCGATAACAGCGTAAACAGGTCAGTCAGGTCTTTTTTT
GCCACCTCGCACTGTAGTCTCTAAAGCTCACCAATAGACAGCAGCTTGCGGAACTTGGTCACCGCCTCGAGCTGCACGTCCGCGTCGCTGGACTGCACGC
CCGTCACCATCTGCGGAAGCTCTGACAACTACACAACCCACCAAACGACTCACAAATCAGTGCGCGCCTTCTCACTGCGCATCCAGCGCCTGCTTACCCG
CTGCATTAGCGATAACTCTCCGGCGGCGTCTCCCATACCAGTCGTCGCCGCAGATCCGCTGTCCCCAGGCGTCTACATGGCAGCCACAACGAACAGTGAG
TCTTCTCCAATAAGATACGAAAACGTCTCCAGGCTACGCCTGTGTCTTCTACTACAAGGCCACAAGCCGATCGACAAGAGAATCCCTCTGCCTCTTTCGG
TTGCTAAGCGTCTGCTACTGCTATGCGTACCATGCGGCGGCGCTGGTTCATGCGGTCCTCCTTGATGGTCTTGCGGATCTGCACGGTGGTCTCCATGCGG
CTGCGACGCGACTCATCCGAGTCGATGCCTTTCTTGAAGAAGTTCTTGCGCTCCGGCGCTTTTCCGGCGGGGAACGACATGGTGCTCGGATCTGTGCGTG
GGCGCGGCGGGCGGATCGGGACGCAACTAGCGACTGCGCGGCTTCTTTCCTTGTTTCCCCTTCTCGAAAGCGCGCGGTACTGGCGTGGACCACACCTAGC
TTTTTTATTGGCGGGCCTCGCACGACTTTTCGCAACGGAAATGATTGGCATATTTGGCCGTGTCTATTCTTTTTAAAAGAAGCTATCATTACGATACGCA
GAGCGGTAGTACACAGAACCTGCGAAAACGAATAGCCAAACGTCACGGAGAGGGTCGGACCTTCAAGCCCCGATGATGAAGCCCTCAAGCAGACCGAAGC
TGTTGCCCGCCACAGATGCGCCCACATCGTCGTCCTCCTCCACACGCAGCGTGGTGATCCACGTGTTCGACGAGTACCGCAAGAGCAGCAAGGAATTCCA
GTGCCAGCGCGACCTGCTGCTGGCCAAGATGAAGTACTTCCAGGCGTACCTGAACGAGGCCAACGAGCACGACGAGATCGACATCTCGGTGCACTGCGAC
GTCGAGATCTTCGAGCTGCTCATGGAATACATGCACCAGCGCGACCACGAGTGGCGGCCGCGCATCACGCTGGAAAACATCGCGTCCATCCTTGTCTCGT
CCGAGTTCCTGCAGATGGAGGAGCTCGTGGAGGAGTGCGTGGCTTTCATCTCCAGCCGCGTGCAGGACTTCATGCTACTGCGCGTGGACTTTGGCTGCCT
GTCCGACACCACAATCGCCAAGATCGCTAACAACTGCACGCCCGAGCAGCTCCAGACGCTGCACGACCCCAAGGACAAGATCCTGTCCAAGCTGCGGCGA
AAAAAGGTTGAAGTGCTGGTGAAGACGCTGCAGCACAGCGGGCGTCGCATCGAGCTGTGTACGCACTGTGAGCTGCTATTCATTAGGGACGATAGGGGGT
GTCTAGGATGCCAAAAGGGTAAGCGCCAGATCGGCGTGCATGGCGAGCTGGTCGGAAAGCACCAAGCGAAAGCAGGGTGGCAGGTCGAACTATTCCTACG
CGAGCTTGGCATCGTCAAGAGTATTTCGTGGAGCGCGGTTTATTGGTACATCTGGGGCTCTACCAAGTACTTCCACTGCAGCGTCTGCAAGCAGAGGTGC
AGCTTGCTTGAGCTGCGTAAGTGCGCCTATCACCCAGGCTCGATCGTCGATTACGGCCCCGCTGCCAAGTTTTCCTGCTGCAGCGCGAGGATTTTCAGCG
CCGACGAGATATCAATGCGCGGATGCAAGGCCATTGCCCACGTTCCGGTTCAAGGCGCCGATAAGCACGCAGACGTTCGCAGCTTCAGCAACGTCGTGGC
GCTTCCCAACATGTGGGAGCAAATCCACGCGTGTGAGAAGGTAGCGACGGCCCAAGGCCCTCCACCTATCGGAGACGCAGGCGGCGGCGGAAGAGTTGAC
GTTGCCTTGCTCTTTCCTCCGCCTCAGCCGAGGAAAAATAGCTCAAATGCTGTGGAGCGTGAGCCATCGTCCAGAAAGCTGAACTGTGCAGGCGAATGCA
ACTCGTTGGGCTACAGGAAGCAATGCAAGGTGCTGCAGCTGCAGGAGAAGGATCGAATTCGCTGCCAGGACATCGCGCGGCAGCTGGTGCAGCAGCGCCT
AAGGAAATCTCGTCTCTTGGACCTATAGCGCCCGCAACCGCGATGAAGGCAACACCGCTTGGGCTCGACGGGGTTAAAAGAGGATGTTCTTGGCCCTGTT
GAGGTATCGGTCCACGACCGCGCCGCATAACGCGCACTTGTACACCTCGCTGCAGTGAGTAAAACTAGCGGCCTCTCCATGGTGGTTGGCACGTGCACCC
CCAGGTTGCGGCGGCGGCAATCTCCTGTTGCCAGGAGCGGAAAAAGGCAACTCGCATTGTACCCCGTTACGGGTACACCGCTACACTGCTCCTGTAGAAT
CAGAACGGAATCAGCTCGGTATGATAAGCGGTTGGCAGTTGGCAGCCTGAGCAGCGATGTGGAAGCGACCGCTGCGCGACGTGGTGGTGCGCTGCCATGT
GGGCAACTTGCGCGTGTCTGGGGTGATGGCACGCAACGCAGTCGACGAGGTGGCACGACGGTGGCGACTGCCGCTTTCCTCCGAAGGGACGAAGCTCTGG
GGAGAGTACATGGCCGGCACCACCATGCTCAGTTCCTTTTTCAAGGGCGAGGAGCGCGTTAAGATGATGGTCAAGACGCCCAACATCCAGGAGCTCTACG
TCGAGGCCATGGCCGTTGGAGAGGTGCGCCCCCACAGTATTATTGAATGGCATAGCAGTGTGCAGTAGCTCAACGACGTGCTCATTGGTTGGTTAGGTCC
GAGGCAAGGCTATCTACGTGGACCAGTCTCTCGCTGGCGCGCTGGAAACGGGAGGGCACATGCACGTCTCTAAGATTTTGTACGGCGCGGCCAAGCCGTA
CAACACTTCTATCGAGGCGTCCGGAATGCCGGAGCTGGACTGGCAGAGATTTTTCGACGTGTCAGAGCAGGTCCCGACCATTGTGCGTATCGATAGCGAA
GCTGCCGACGACCACACACGTAGCTGCGGACTCATCGTCCAGAAAATGCCGCCGACAGAGGCGCATGAGCGCCATTACGAACTAGAAGAACTGGCCTTTG
ACAAGCTCCCCTTCTTCGCTTCTGAGTTGAAGAAGAATACGGATCTGGTCGAGTACCTGAACGAATTGATTCCAGGCGCCGATATCACGGACAAGAACTG
CAAGCGCATGCCACTGGATTACTATTGTCGCTGCTCCAAGGACAACTACGCGCAACGACTCAAGGACATGGGCGCAACAGACTTGAAGCAGATTGCAGCG
GACGTGGGCAGCGCTGGCGTCGATCTCACCTGCCATTTTTGCAATGACGCATACCACTTTTCTTCTGGCGAACTGGAAGGTCTGATCGAGTCGCTGCCGA
AGGCATAATCAAATACGCTAAAGCAACGAGGTAGTATATCGACATGGTTATAGAATATGACGAAGTCATCATCTATGCGTTTGCCTAGCCCTCCTGTCCG
AACTCCTGGGTCCACTTCACGAATTGGCTGAGCTCGTCCGAAGCAACAGTAGCGGTAGAATGCTCCAGCACGCGTGTAAAGTCACTCTGCAGTTGAAAAC
AAGACGACACGAGTGAGTCAAATACTAATCAAGACCACATCCAGAGCGAAGCAGACCCTTACCATTGAGATCATCGGCGGCCGCAGCTTTTCATCCGAGT
AGCCCCGTTCTGGCAAATCGTACAGACGCATGCGTAGCGCACCGCAACGTCGACATGGTGCCTTGCAGTCCGGACACTTCGGACGGCACGTAGAAAGCTT
CATGTGACAGTATGCGCACGGTGGGTCACCTTCACAGGGTGTCAAGAACGGACCGTTCCGAACGGGGTGTGCCTTATCATTGCACTGCAAGTAATGAGAT
TTTTGATGTTGTCAGTAAACATTCACACCAAAATCGGATGAGTTACCGCATCCTTACCGGAGTAAAGAATTGGGCTTGTTGGCACTTCCGGAGGGGCTCC
ATTAACGCATCTCGAACAAGCACCGAGATATCTGAACCAGAGCAACTAAGAAGATGCAAAACAAATACAGTAACTAATATCAGCTCGATGTTCCAAACAA
AACACCTTGGTGTTGCAACGTACCCGTCTGTTTTTTCCGCAATGGCAGTGAAGTTTGAATCGCTTAGCTCATTCGGAGTATCGCCCAGGTGGATTCCTAG
CATGACCTTGCGTGCATCCGTGTCAGGAAGAGGGATGTAAATGCGCTTCTCAAATCTGCAGACAAAAGTTCAATGTCAGCTATCCGCAACCAGATGCCTG
TGCTTCCTTCAAACAATCATATAAAGTAGTACGGATTTACCGTCGTCGCATGGCTGGATCAAGCTCCCAGGGTACGTTCGTTGCCCCGAGCACCAGGACA
CCGTCATGATTGTTGCCCATACCCTGCATTTGTACGAGGAACTCATTCTTGATGCGACGCGTAGAGTCACTCTCGCCCTCGGATCTGCTCGAGCACAGCG
AGTCGATTTCGTCTATGAAAATGATAGCGGGTTTCTTCTCGCGCGCCATCTCGAAGAGGTTCTTGACAAGCCTGCACGACAGCGCATACATCTTATTTCA
GCTACAGCAGCTCAAATTCGAGTTTCATCACGCCAATGCGAATCATACTTTTCGCTCTCGCCTTGCCACTTGGAGACCAGACTGGAGGATGAGACGGCGA
AGAACGTGGCGTCTGCTTCCGTTGCGACCGCCTGTGCAAGGTACGATTTGCCTGTACCCGGCGGCTACATCAATAAACAGCTTAGTGTACACCATGCTTC
CCGACTTTTACGGCAATCACTCAAGAGCGCACCCCATATAGCAGAATGCCCTTCCAAGGACGGCGCTTGCCCGTGAACAGCTGGGGGAACCGTGCAGGCA
GAATCACTGCCTCTTTCAGCGCCTCCTTCGCAGCATCCAGTCCAGCAACGTCGTCCCATTTCACATTAGGCTTCTCCGTCACAACCGCCGCTGCACAGAA
TCGTTCAGAATGTGCACATCAGCCACAGCAAACATGAAGAACCCATACTCGGAATCCTGAGTTACTCACAAGCCAGGGAACCACGTAACTTGGCTGTCTC
TGCGTCCGTCTCATCGTCGTCTTCCTTCTCCCCCCTATACACAGCAGCAACCTCAGTATCAAAACAGCACCAGCACAACTTGCACGGCAAACAAACGTAC
TTGTCCATGTCCACGGCGGCGGCCACCGCCTTGGGCGCGTTATCCTTCTCCAGCATCCCCCGTAGCTGCTCCGCCCGCGTCATGTAGCCCTCCACCCGCT
TCATGATGATCTCCTTCGATGTCGGATTCTTCTCGTCTGCAGGGCAAGAGTCAAGTTAGCTGCATTGCAACATTGGAAGTCGGTACCCGTACGCCTCCTC
GCTGGAGCTTCAGACGTACATTTGACGCCGACCATGAAGTGCTCGAGTGCCTTCTTGTACAGGCGGAAGGCCTCCTGGTAGTTCTTGCTGTTGTCCTCAT
TGATGGCGTGCGTCACGATCTCGATCGCCTGCGGGATGAACTTGTTCTCCATCGCGGCACCACCTGATCAATGCGGCGCAAACTCAAGTGTAACATGTAA
GAAAATCCACGCGACATACCATAAGCCAAATTCCGTTTGTTTGACATATCATAGGCCAAATTCTAAAGAAAAATCGCAAACTGATTTTTCCGATACAATA
TCTCTGTTGGATTATCCAACAAGATCGGATGAAAGATATCTCCATGTAAAGGGTCATCCTGCTGCTTCTGGCTGCAATGGGCGTGAGCCAGTCGAAGGGC
GGTGGCGCCGTGGGGGTGCGTTGGAAGCTGCAAACGCTGGTGCCTCGGTCGTGGGGGGAGCTGGAGCAGCTGCATCTGCGTTTCCAGCAGGAGGCCCACC
GCCGTCGAGCCGACCCCGTGTTCCAGTACTTCCTGCCGTTTCCAGTGTTCCAAACTATCGTGGCGCCGCTGTGCCCCGACAAGGACAAGCTGCATCTGCT
TGCCATGTTCGAGGCACTAGATGTCAAGACGACGAGGAAACTGGCCGTGATGGACTTCTTCAGTGGGCTGGCGCTCTTGGTGGATGCCAAGAAGCCTCAG
AAACTCGAGTGTGAGGCGATGCACCGGGCGGTCTAAAGCACTAGTCCTAGTGAGGGTAGCTAACTCGTACGCGTGGCTCCAGTTGTGCTGTCACTGCTGG
ACAACGGAGGCCTGAAAACGCTCAACAAATGCGAGTTGACGATGGTCGTGTCTGCAGCGGCCAGGGGATTGAAGATGTTCGCGCCTGAAGCAGACGTCTT
GCAGGAATCAACCATGAGGCCGCTTATTCGCCGTAAGGACTGCGGCTATGATTTATGCACCTGTGTCAGCTTAGCGTGTCTGCTTTGCTGCAGGTCTGTT
CGGAGACAGCAGCGAGGTTCTGCGGCAAACCATCGTCAATAAAGCTCTCGCAGACCCTGAAATCCTATTTTTCATGAGCGATCTCGAGTCGGTAAGTGTC
TATAGTTTGTAAGCTTGCTCAATAGCGCTTGCTTGGATTTTATTTGTCTGTACTGCATGCACAATAGGGTGTAGCGACGTCCTCCGATGAGTTGCTGATT
CAACAGGGAAAGCTCATGAGACATATGGCCTACTTGGACTATCAAGCCGCACGCGTTAAAGCGTCAGGTATTTCAATATTCTTGAATGTATACGTCAATG
GAGTCCAGCTCATCTTTTTTGTCATTGTAAGAGGAGCGAGGAAGGACAGCAGCGGCAACTGCTCCCATGAGTGGAGTCGGTGAAGAAGCCAAGGGCCAGC
AAGCCCTGACAGTGACATTGGTCCCCACAGCAGAAAGTTTTTCGCGCAGACTTCAGAGTATTGTGTGCCCACCCCCACCAAATGGGTCAGACCAGTCAAT
GCGCGTGCTATCTGCAGTTGAAATTAAGAAGCATGTTGACCCACGCACACTCCAGCGGTTGGTCAATATTGTTTCAGATGGCGGTCTATCGCTCTCATGG
AAAGAGGTTGATTTGCACGGCAAGTATCCTACCTTCATCGAAAATACTGATTTATGCATTGCTTGTCCCTCCTTCAGGCTGAAGCACTCTTGGGCGATAT
GACTTCAGACCAGTTTGGGCTTGTACGGTGCGGCGACATTCTGCGCGTCATGAAAGCTTGGGTACAGAATCGACGACGAGAGAAACCAGAAGCACTGTGG
GAGTTTGTGAGCAGCTACGTGGCTGACGGTGTTAAAAGCATCGAGAAGCAAATGAATGCTGTTCTTGTTGCGATTGTCAAAAGAGCAACGAAGGCGCTGG
GGCCTACTGTGCGTCAGCGGACGGCTGTAGCTAAAGAGCATTTGCTTGAAAGCTTGCAGAGCGTCGCACTAAACCCTGATACTGACGATGGGGAGCTTCA
GTGGAGTCTCAGCATTCGAGTTGGCGAGACTGGTCTGTCGGTGCTAGCGCCAACAAGCTCTCCGCCTTCGAAGCGTCTAGGCGCTCCTTTAGGAAATAAC
ATCAGATTTCGACTAGGGATTCATCCACCGAGTAGTGCAGATGGTGATATCGGTGCTAAGGCCAAGTTCGAAAACGAAGGGCAAGCGAACAACGACAGTG
ACGAGCTAAAGGATATTGATTCGGAAACTATGCGCCTTTTTGCCAACTTCTTACTAAACCCCGAAATCACAGGTAAGGACCGCCGTCTTGATTGCGCTGT
GTTTTTTTTAAACCCAAGTTCTATGCTTGATTAGATGAAGAAGGCATCAACGTAGCATCATCGGTAGAGAAGGCATTGCAGCAGGAGCTGGTCTGGTCAT
CATTTGCATCTCTATGGACGAAATGCTCGGGTTCGGACTTACGATACGGAACTGTGACGGGGCTATGATGTGGGCTAACCTACTTGTATTTTGTATAATT
GTTGTAGTTACAATGCATTCGGCAATTCGAAGTGACAGAGGAGGACAACCTGTCCTTGACCAGTATCTTCGCGTCTGTATCAACTTCCGCGAGGACTTTA
TCTCGAGTGTGGAGGTAAGCTACCGCGCTGATAAGCGTGAGCAGACAACGTTTTGGGCGTTGATATTCACGTTATATTCATTGCGCAGGAGTGCACAGGT
ACATCGTTCGCGGTTGGAATTCGTAGCTTCTTTCTCTTGGTTGAACTGGAGCAATCTTTGGTGGATATTGTTGAGGCTTCACTGGATATGTCTGCGATGC
TTCACAGTCTTGGCAAAAGGCAGAATCGACAACGCGCGATGAGGATGATTTTTGATGCATTTGATGCAAACCATAGCGGCGAGTGGAGCCTTCAAGAGTT
CAACACTTTCCAGCAAGCACTTGGAAAGGAAGCTCTGCTTGAAATCACCCTAGCGGAGTTGTTTGGCGGATCCTCGTCGATTTCATTCGACCAGTTTGTT
ACAATCTACGAAAATTACCCAGTCGCCAAACTACTCGAGATGATCCGTCAGCTAGAAATTGGTAGGGGTACCTATTCGTGGTGGAACGTTATGGATTGCT
GTACTCATGACGATATTGCTGCAGGCTCGCTTGGCAACATGATAAAGGGTTCCGTATCAATAACATCGACACTGAATGAACCATGCGTAAAGGCTCTGGG
CGTGTTTCTAAGCCCGCTGCGCTGGGCTGACGCGATGTGGAAAAAGCTGCTTCTTTTCTCTAGAAGCACGAAGGATTTAAACCTCGAGCTTCAGTTTTCC
ACGCTTTCGGATCTCCTACAGAAGAGCTCTCGTCGTGTCGGAAAGCTGGATTGTATCGGGGACCCACTGTTTGTAGCATCATGGATGAACTGTCTGGAGG
AATTTGTGCAGCCACCACATGCAGAGCACTTAAAGGATCGACCATGTCGAAGTATCTTCTGTTCGCTGGAGAGTGAGATAAACAAGACGGAGCAGCAATG
GGAATTTGAGGACCAGAGTCGGAAGCTTCCACGGGGTACATCTGCTCGCCGTGCCGAAGCCATGATTCCAATTCTGGAAATGGCAAAGCTTGTAAAAGTG
CACGTTAAAGGACTAGTATTGTTGGAAATGCGTAGCAAGAGCATTCGGATTGTGTGCGAACTTGACAACCTCTGGATGGCGCGGCCAAGCAACAATAATG
AAGAAGTCGACACTGGAAGAAGTTGACCTTGGGTAACGCTACTTTTATATTTGCGAGGTAATAATAGGTCATTTTAGTTACGTGTCGACGTGCTCAAGGC
GAGAGCGATATGATTCAAAGAATACTTGACCTCGCTTGACCCATGAATCGTCCAGTGACGGCGACATCAGCTCACAATGATGAAGGGGGCTTGACATTTT
CAAGCGAAGAGTCCAAAACTGCGTATGCCCAAGCACTTGAAAACCGGCATCGTGGATTGTACCAAGAGGCCGTCCATGAACTGGAACAGATCATCGAGGT
AAGTGATGACAACGCTCGGCCCACGAAGAGTGGCGTACTAACACGTATTTGCTGGCAGCAAGAAGGCGACTCCGAGAAGCTCTGGACTGAGCTCGCACTT
GCACAATTCCAGCTTTGGGAAGCGCATGTCCGAGCATTACACTTGCCGTCCATTCTAGTGCTCACATCAGCAACGCAATCCAAACGACCCACAAGCGCCA
GAACCGACACCAAGCCATTGCACATGGTGCTGCTTCAAGAAGTCTACAGCACCTTCCTCATCGCGATGGAATATCCAAACAGCAAATCAAGCCCAGAGCT
GTTGCTCCCACTGGTGCGGCTTTACATCGAGTTTGGGTCGCATCGGGGTGCACTCGCCGTCTGTACACTGCTGGTCGAAGGATATTCAACGTCTCCACGC
CTCAATGAGGCCATTTTCTTGTCGGCACTTACAGCATCGGCACTGGGGCGCCACCGTGAGAGCGCACAATATTTCCAATACCTAGCGGAGGGGCCGGGGC
CGTCGTCATCGTTCCCGTATCGCCTTGCTGGCTATCAACTGAGCCTGCTAGCAGCATTAGAGCTAGCCCGGGTGCCAGGTATGCGCGCACTGGAGCGTGA
GATGTATACCCAAGCGTACAAAGCTTTGGTTGTGCTTCCACCAGTACTGCCATCGGAGAAGACAGCCCACACGTTGTATACGACATCGAGAAAAAATGAG
GAGCAGCGAACCTTACTATGGTGTCGCGACGTGCAAACATGGTTAGACCTTGCTCAGAGACTTGCTGGACCAGCCAATGCTCCGCTTCTCGTTCTATTGG
CAATTCGTGAAGCGCGGCGCCGGTCAACAGGAGAAACAGGAGTCTTTCCTACATCAAAGCTGCTACTGGAAGGCGTTAGTCTGTTGAGGACGAGAGACAG
CTTGGGTGCCGAGAGGGTACTTGGTGAAGCGATTTTGCTGCTACCTCGTGATACATACTACAGCGCGCGGCACGAACGCTTTTTACTGGAGCTATGCAGT
GCCTCCTGGCGTGCACAATTCGCCTTGGAGCACAAGAGTGCTGCACGTCTACAAGTATTGCATCGGCGCCGCCGTAAATTAGCGCAGTGGCATCTTGCTG
TCGCTCATGTTCTGGAGCAGCGTCGCCATGCCATGACGTTGCGCATTCAATGCGCATGGCGGGGGTTCATAGCAAGACAGGAGCTTGCATCCTTGCGTCG
AAAGCAGCGAGAGAAGGAAGCGCTGGCTAATATGACCATGGGTGTGCACGACGACAGACTCATCGAGCTACGACTGAATGCAGCCGCAAGGAAAATTCAA
TCTCTGCTTCACATCGCGCGAGCAAAGAGGACGATTCGAGTCCTGCGAGCCCAGAAAATCGAGCGACAAGCTCTCCTGGCAAAGTTTGCTGGTCGCCGGA
CCGAACTCGGTCAGCTTGGTGTATTTCGTAGATGGCGAAGCTTTGCTTCAACCCAGAAGCAAGAACGCCTTGATGCGGTCGTACGAATTCAGCGCCAGGT
TCGAGCCTGGCGCAGCCGCAAACTCTGTTTTCAGTTGATATTGCTTCGACAGCAGCAAAATAGTGTTTTGCAGCAGTGCCTGGCACGGCGCTCGACTTCG
CTCATTTCACGCGTGCTGAAAGCCTGGCACACGGTGCTTATCGAAGCTAAGAGTGAGCGAAACTGGGCTTCACGGCTGATTCAACGCAGATATCGTTCAA
GGCTAGCAGTACGCCAATATCATGTTGAGCTGCGGCGGCACCGAGCAGCAACCACCACCATGAATCGTATGCTTTTAAGTCGCACGCAGCAAAAGCTTTT
AAGCTCATGGCGAGCCCTCGCAAACCACGCGCTAATCCGTCGTCTGCGCAAGCGCGGAGCTGCTGTGACTATCCAGAAACACATTCGAGGCGCACTTGCC
CGGCGACAAGCCAAGCGCCTTCGTGCACGTCGCCGCCGAGCACTCAAAGTGCTCGTAAAGCTCACACGCTCGCGCGAAATACAGCTTCAACAGACAGGAT
TCGATCGGCTTTGTCTACATGTGCAAGAGCACCACAGAAGAGCACATGGCGCAGTGGTATGCATACAGGGGCTCATTCGGGGATTCTGCTGCCGTCAAAG
GCTCCATCGACGGCGTACGGCGGAGATGCTGGTTCAAGGGAGCGTCTTCGGCAGCGCGCTTAAAGGGCAGCCAGCAGACATCGTGCTATGGGCATGCTTG
ATGGCGCTGTCGCGATATATTCGACAACGAGATGCCGCAGTCGTTCGGCTTCAACGATGGTGGAAACAGCGGCAAAAGCGTGCTCGAATGATCCGAGTAT
TGAGCAAGCGTGCAGCTCAGCGTCACCTACTCGGCAAACTGCAGCAGAGTTTCTACACAACTGCAAGGAGCTTCCTCCGGGCGCTTCAGACTGCTATCAA
CACCAAAAAGGCCCGAAAGCACTCGGCAGCGACTAAAATCCAACGACGGCTACGATGCTGGGTGATGCGCCGAAGGTACCTTAGTACTCTTGATAAACAC
TCAGTCGCTGCTCAACGTGGTGAGAAAGCAGCAAGAAAAATAGCGCTCCAAAGAGTACGCCGCTTGTATCATGGCTGGCGGGATGCAACGCGGAAGACGC
GACAAGAGCAGCACGAGGCAGCTTGTCTGGTACAGCGAACTTTCCGGCGGCACCGAGCGCAGCGGCAGGCACGTTGTGTTGTGGCAAAAAAAGCAGCACA
AGCACGATTGCTGGCTGCAGCCTCACAAAAACCGTTGGAGCGCTGCTTTCGTCAATGGGAGGCCACAGCCCTGCTCGAAAAGAGTGTGCTGCGTGTGCGC
AGTTCGTCACTCATCGGCTCAAGAGAAAGCACCCCCGTGAGCGGCCAGCGCAAGCTCGAGATTTCTTCTGGTGGTAGGTTCGACAAGACTCCGACGCTTG
AGGAGGTAAGCTGTTGGCTGAGCTCTACAAACGTGCAGCGTACGCTAACCCACCAATGTCTCGTGCTCAGCGCGCCAAGATACCGTCGATGCTCTTTTTC
ACGGTACTCAACCGTGTGCGTCAGACCGGGATTTGTCAGCTCTCTTACAGGTACGCCTTGTCGAGTGCACTGCTGTTCACACAGGCAAAAACTCACTGCT
CACAATGTTTTGAATTTTCCAAGCGGCGGCACCGTGTTCAAGGGTCCTCAACTGCGGCAGTTGATCTCATTGTCCACCAGCATAATCGTCGACAGCGGTG
GCGGTCTCTCCCCAGCCTCCTGCAGCTCTCTTCTCAATCTCAACGAGCAGGTCGTGGAAGCTCTGGAGGTGTGCTCCAACTCTGGCTCGGGCTGTCCAGT
TCAATCGCTCATCTTGTGCAATGCGCCGCTCCGGTCCCCCCACGCGTCCCTGCTAGCCACTGTATTGCAGCGCAGTCGCAAAAGTTCCAACCTCGCTCTG
GTGTCCGTGGTGCTTGCCAACGTCCCTCTCGCGCTCACGTCCGTTGTCTCTCTCGCCTGTGCGCTGGCTCAAAGCCCGAGCTGTCTGCAGCAACTGGTGC
TCGAGCGCTGCCAAGTGGGCAGCGCCGGGGCATCAGCTTTGTTCGAGGCGCTGACTTACAATCGCGCGCTCTGGAAGCTCGATCTCAGCGGGAACCACAT
TGGAGACGCCGCGTGTCCCGCTCTGGCCCGCTCCCTCCTCGCTGGCAGTGCAGTGCGCGTGCTTGCGCTCAGCCGCAACTCGCTGTCCGACCGGGGTGTA
CTGGGCTACCTGTCTCCCGCATTGGGATCATCACGATTGGAGACGCTCGTGTTGCTGCAGAACCCGCGGGTGTCGTCTCTGGGCAGCGCGTCGCTGCATC
AAGCTGCTGCGTCCTCTGGAGATCTTATTCGCGTCCTTTCGGACGGCGGGTTGTGATTGGCAGATATCATGGCTACATGTAGCCATGTTGTCACCAAGAG
CGTGCTGATTGGCTGAAGGCTGGCTGGACGGAGAGCACCCTCGGTACCCTGTACGTCAGTGGATGGTTCAGCAGAACCGAACACTCCGAAGCCTCCACCC
GACTCGTAGCACCATGGTCGACGCCTCCCCCGTGACCAACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAGTATAGCCACCTGATTGCACGCCGC
GTGCGCGAGCTGCACGTGTTCTGCGAGCTCTACTCGTGCCTCGTGAGCGCCGAGGAGCTGCGCAAGCACCAGCTGACGGGCATCATCCTCTCGGGCGGCC
CGCAGTCCGTCTTCGATGAGGGCGCGCCCCACGTGGCTCCTGAGGTGTGGCAGCTCATTGAGGAGCAGAAGATCCCGGTGCTCGGCATCTGCTACGGTCT
CCAGGAGCTGGCTTTCACCTACAACGGCAAGGTCGCGCCCTCGCAGCACCGCGAGTACGGCAAGGCCATCGTCAGCCGCAAGAACGGTGTGGACTGCGGT
GGCCTGTTCGAGGGCCTGCCCGACGAGTTCCAGATGTGGATGAGCCACGGCGACAAGCTGCACGCGCGCCCCGACGGCTTCGTGGACATCGCCACCACCG
AGAACTCGGAGCACGCCGCCATCGTCAACGTGGAGCGTAAGTTCTACGGCATCCAGTTCCACCCTGAGGTGACCCACAGCCCGCGCGGCAAGGACATTTT
GCGCAACTTCGTGGTGACCATTTGCAACTCCCCCACGGACTGGGACATGCGCAGCATCGCCGACGCCTTCATCGAGGAGGTGCGCGAGACCGTCGGCCCC
GACGGACACGTCATCGGCGCTGTGAGTGGCGGTGTGGACTCGTCTGTCGCTGCCGTGCTGCTGCAGCGCGCTCTGGGTGACCGCTTCCACGCGGTGCTCA
TTGACAACGGTCTCCTGCGTAAGGACGAGGCCACCGAGGTCGTTGACCGTCTGCAGACCAAGCTGGGCATCAACCTCAAGTGCATCGACGCCTCAGACCG
CTTCCTGGCGGCCCTCAAGGGTGTCACGGAGCCCGAGACCAAGCGTAAAACGATCGGCAACCTGTTCATTGAGCTGTTCCAGGAGGAGGCCGAGCGCATC
GGACACCCGGTGGACTTCCTGCTGCAAGGCACGCTGTACCCGGACGTGATTGAGAGCGTCTCGTACAAGGGCCCCTCGGCCACGATCAAGACGCACCACA
ACGTTGGTGGCCTGCCTGATACGATGCACCTGAAGCTGATTGAGCCGCTGCGTGAGCTGTTCAAGGACGAGGTGCGTGAGCTCGGTATGGCTCTTGGCAT
TGACGAGCCCAGCGTGTGGCGCCACCCGTTCCCTGGCCCCGGCCTTGCCATCCGTGTGCTCGGCGAGATTACGCCCGAGGCTCTGGAGACTCTGCGTCAC
GCTGACTCGATCTTCATTGAGGAGCTGCGCAACAGCGACCACTACAAGACGACGGGCCAGGCTTTCTGTGTCCTGCTGCCGGTCAAGTCTGTCGGCGTCA
TGGGCGACGGCCGCACGTACGAGAAGGTTGTCGCCATCCGTGCCGTCAGCACGTCGGACTACATGACGGCCGACTGGTACCACATGCCGTACGAGGTGCT
CGGCCGCATGTCGAACCGCATCATTAACGAGGTGCGTGGCGTGAACCGCGTCGTGTACGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAA
GCGGTATGGTGCACTCCTCGTCTTTGCCACCATTTCTGCAGCTCCGCTCTACAGGGTTACTAGGAATACTACCGGTAGGCAACGGCGGAGGAAGACACTA
CCCCTTACGGTAACGTCGCGCTAATAGAGCAACGATACATGCGTGTACACTAACCAAGATCAAATGGAGCAAAGCGGCAGGCACGCTGCCCGTTCATTTT
CATGAAGTGCTGCGACTTAAGCGACAAGAATTCTTGGCTTCAACCGGTCAGTAGTAACGGACGTCAATTGCTCATTGAAGACGTCGCTCCAGGATGCTGG
CCCTCAGCGCGTACGAAACACTGAGTGTGCTCGGCAGTGGACAATTCGGCAATGTGGTGCTCGTTCGGCGCAATTCAGATCGGAAGCTCTTTGCGGCAAA
AGTTCCCCACGGCGAGGACACCGCAGCGAGGTTGGCTGCTCGTCAGGAGGCTCAGCTACTTATGCAGTTGCATCATGCGAACATTGTACAATTCATCGAA
GTGGTTGAGGAGGATTCGCAGATAGCACTGGTGATGGAGTATACTAGCGGCGGAGACCTGGATACCTTCTTGCGATGGCAACAAGAAAGCACGTAAGCTC
GCGAACTCATCTGCTTGAAGCATTTTCATTTTCACAACCGTTGATGTTGCTCGTAGGGGATTTCTGAGCGAGCCTGCAATCATGCGCATATTCATCCAGG
TTGTCCTTGCGCTCCAACACTTGCACGAACACCGCATTCTGCACCGGTACGCAAGCTTAAAAGAATACTGCTCAGATGCCAACGTGTAGAGCGACCCACT
CACGGCTATAAGTGCCTTGTTGTACATGTAGAGACCTCAAACCGAAGGTACATGGCTTTAGCTCGGGAGCCGGTTATCGTGAACTACTTACCTACATGCG
CGAACGGTTCTTGCTAGAACATCCTACTGGATGGCGACGGGATCGTAAAGTTGAGCGATTTCGGCGTCTCGACGGTTTTGCAAAGCTCTGTGGACTCTGC
TCAAACCATCACTGGAACCCCACATTACATGTAAGCTACAATCGTTGTGCTTCTTGGTCTAGGGTATTGTTTTCATGATGCTCGATCTCAAGGTCACCCG
AAATTCTCGACGGAGATTCTTACGACTGCAAAAGTGACGTCTGGAGCCTTGGCTGTGTGCTATATGAGCTGGCAACCTTTTCCCCACCGTTCACTGGCTC
AGCCCTTGGCGCGGTTGTGGGTCAGATTCTAAACTGCGACCCACCGCCAATCCCTTTGTGTTATACTCCACCATTTCGAGCTCTCGCAAGCAAACTACTC
GAAAAAGACCCCCGTGTACGCGACAAATGTATCTGATGGATGCAGCAACACTTCTAAAGCAATGTGTGTGAAATATGACAGCGGCGACCAGGTTTGCCAG
AAATCCTGACTTGCCAAGCTGTTCAGCACTCCATGATGCAGCTAGTGAGCGTTGCTACTTCGCATCAGCCCATGCTCCTGGAGCAGTTTGCTGCAAAAAA
GAAAGACTGCAAAGCTTCACAGCAAGATGAGATTACTCTTTCAGAGGTGGTAACTCCACTTCCCAGTCGTCAGGGCCTTGGTAGTGCACATCAAAACAGT
GACCAAGCCAAAGGGTTCATACGTAAAATTCAGCCGGAGACAAACGATGCTCGTCAGGTTTTCTTCGAGAACCAGGTACGATGCACTTCGAAGTACAATG
CAATGAGCCATACGAATCTAACGCGCATCACTCCTCCAGGCAGCTGCTCGAAAAAACAAAGAGCGCATCGTCCAAGAGAGATCATGTCCAGCAGTTTTCC
TTGACTGCAACGATTGTAATTCGCCAGATCACCACACTCAAGTCCAGGCGCAGATACAGAAGCCCAGCCTCATCAACAGCCCCAGTGGCCGACAGATACT
AGAAAGTTTTGGGTGTTCTGTTGCAGTAAGCAAGCCCGATATGCCGCCCGCACCTTCGTCTTTAGTTTCTGTCAGAGGTCGAGCTCAGTCGTCACCGTAC
GTTGTTACCATAGCTGGATCGCCGAACATTGAAACTAACACTAATCCTTTCAGCTCAAACTACGAAGATCTACTAAATAATGAGCGACGACGCGTGCAGC
TCGAGACCAAGGCGTTGCAAGAGCGAATGCGAGTCATGCAGGCCACAGACTGAAAAAACTTCGACTTTTGCGGATCAAAGCTGTGGAGTAGCATTTAGAG
TGGAAGCCTGGAAAGAGAAGGCCAAAAAGAATGGATTATCTACTGTGGTGCTGGGCTTGAACGACTGTTGGAACCGATCACTACAGTTTTGCAAAACTTT
TGCCGATCATTACTCAGAATGCATACATACATGTATCGTGGGCTTCGAGAATCTGCAACCTCTCTACTGATCTTCAATTGCTTGCTGCATTGGGCCCTTC
ATTTCGTTGCGATCCAACGCTATTAGTTGTGAATTCATTTGTTGGGGGTAATGTTTCTTTTCGAGTCCGAAATATACTACCCGGTAGTCATGAATAATGC
TCGGTGTTGAGATTCTCATCCCCATCAAAGCACCATGAAGGCTAACCAGTTCGTCGAGTTCGGGTGCGTCCCAGCGCCGTCGATGCTTCAACTCACTCCA
TAATCCGCCCCCCCCTACTAAATGATCCAATATCCCCACCTCCTACAGCAAAAAGATCGTGGCCATCGGAAAGAACTACGAGGCCCACGCGCGCGAAATG
GGCGCGGCCTCGGCCCCCAAAGACCCCGTTCTCTTCCTCAAACCCACCACCAGGTACAGCAACAGTCGGCAATGAAATCTCGCGAAGGAATCGCTGAATT
CTGTGACTTGTGTGGGTAGCTACGTGCGCAATGGCGGCAGCGTGTTGCTCCCCCCTGGAATCGGCGAGGTGCATCACGAGGTGGAACTTGGCGTACGTCC
CCTTCCTTGCTTTGTCAGGAGGATGGGTAAGAGGGTCGTGTAGTTAATAACCTGGTGGGTGCTTAGGTGGTGATCGGCAAGGGTGGCAAGGATATCACCG
AAAGCGACAGTATGAACCACGTTGCTGGCTACGTACGTACATCGACTTCACATGTAGATGAACCTTTGCTCTTTTTGTTTATTTTTTTTACTCCACTGAT
TTGCATGTGTTAGGCACTGGCGATCGACATGACGGCCCGTGATGTGCAGGCCAAGGCAAAGAAAGCGGGGCTGCCGTGGACACACGCCAAGGGGCTCGAC
ACCTTCACGCCTATCAGCGACTTTATCCCTAAGTCAGCGGTACCTTCGCCTCACGACCTCAACCTCTGGCTGAAGGTGGACGACGAATTGCGCCAGAGCG
GCAACACCAGCGACATGGTGCACAACATCCCATTCTTGATTTCCTACGTCAGTCGCATCATGGCGCTGGAGGAAGGCGATTTGCTCATTACCGGCACGCC
GGAAGGAGTTGGACCTGTGCCAACTGACAGTGTACGTTTCTTCCTTTGCATTCTGATCCAGTAGCCACTCTCTTAGTTTGTTTATTGCTATCGTGTTGCA
TAAAGGTGATCACTGCGGGCATCACCGGTCTGATCGACGTGCGCTTCCCCGTGGAGACGCGGGTGTACAAGGCGTAGGTGTGCGTTTGTACTCCGAACAA
TAAATGGCACTTTGCTCAAGTAAAGCTGCTCGATTAGCTGCAAGCTACAATTCGAGCCTTGGATGTGGTGGAGATGAGTACATTGCATGGTGTTAAATAG
TTCTAACGCTGTTTAATGGGGGCTGTCGCTGCTTCAACCAGCATAGACAACTTTCGGAAATTCTGTCTGCGTCTGGAACCAGCGAAAGTCGTCCGGACAT
GCCAGCCGCGGTAGATGGCCTGGATACGCAACGCCGCTGCATCATGTCGTAGGTTTCGTACTGCGGACTGAGCATAGGAACGCACTTCTGGCCGATTTGA
CGGTGCTCTAATCAGCCGCATCAGCGCACCCAGCACACCGCTCTCCACGAGTCTCGAGCGAGCCACATGCAGCTCGGACACAGCCGCCAGCGCACGTGTA
GCTTCCACAAGTAAGGCCTCACTCACGCCCCTATCGCTGCTGTGGCCAACTGTATGACTTCGATCAAGCGGACTTACGTATCGCACTAGCACAGGCAGGA
GTCCAGCATCCACCAGCTTCAGTACATTTTCCGGGCGCTCGGCGAAGTTGGCAATTATCTGAGCTACGTGAAGTCGAGTGGAAACTAGCGGATGGAATGC
AAATTGCCCCAGTGCTGACAGGAGCGCGGGCTTACAGAGCGTAAGACGGGAGGGTGCGTCATGAGTGAGCTGAGCGAGTGCACCTAGAGCATCCACTTTC
ATGCCAAAGTCATCGCCAGCCAAGATGCCAAACAAGCACTTAACGACTCCGCGTGCCAGGAGCTCGATATAATGCTGATAGTCACGCTCGGAAGCTTGGC
TTGCTTCCCATGAGTGTGCTTGTGGACTCCCAGCCGGATTATCTTCAATACCCTCCGTATTCGCGGGATCTTGTCGCCGTTTGCGTTCGCTGCAAATTAA
CAATGTGAGTAACGTGATGACTGCACGGCGGACGCGTTTATCGGGTGAAGCGTATAATTCACGAGCTCCGATATGATCAAGCACCTTGGAACGAATAACG
TGCTCTCGGTTTGCGGTGTTTTGAGCTATAGCGCAGAAAATTACCAGTGTTGCTCGAATTACTGCGGTTGCCTCGGACGCTGGCCACATGGATGCAGACC
GCAAGCGGGGGCGCGTTGATGAAGCCGATCGAGGCCGGGAAGCAGACATCTTTGACTGGATTGGTGTCGCTGATGCAGTGCGCGGGCGTTTATCGCCTGC
ATCGGTTGACAGGCTGCTCGGGGAAGAAAAGCAGAGCTGAACGAGCCTCGACATTGCTTCAGCTTGTACAAGTGCCTCGTGGTTAGCGTTATCTTTTGCG
ACAGCATCAAGAATGGCCACCACCAGCAGACTCACTTGAAGCGAGGGCCTAGAAGCACAAGATGACCCGCGACCTAGTACGCTAAGCACGCAGGGCAGGA
GCCCAAGCGAAGCGAAGCGACGAGCATTTTCCGCTTCGGATAGTAGCAAGTGCACAAAACTCAAAAGTTCGCGGCGGAAGATCGCGTCCTTGTCCAGGAA
CGGATCTCGCAGCAGCCCCGACAGTGTCGTGAAATGGCCTGAATAGTAGAAGAGCACTCGGTTATCACATGAAGCTGCAAGCTGGTGTAACACGGATGCC
GCTAGCGTTCGCGTGCGTGTATCACTTGCCCCAACATTCCTTGCACTCTGCGGGACGCCACTGCCAGAGCAGCAATTCAGCATAAAAGCAAACCCTTCAC
GTTTGGCCACGGCTTCGCGCCACTCGTCTGTTGTCACCAAGCGTGCGACGACTTCGAAACCAGCCAACCGCAACTTGTGGTCTGTAGTAGTGTGCAACAG
AGAGAAGACGCAGTCAATGCCCCCTGGTGCTTGAAGGAGTTTGGTCTTGATTGTCGATAACCGCACAAGCGCTGCCAGTGCTTGTGCACAGTCGTGAGAT
ATCCCCGAGTCTTCACGATCCACCGGCGAACTGAGCATGGTCAAAATCGCACCGAGCGTACCAACTTCGTCAAGTAGCTCAAGGTTCGCGGCTGCAACAC
AAGGGAGAGATTAAGGTCTGACACCAAACACCTCAATGGACATGAAAATGAGGAGAACGCACAATTACGACTGAGAGAGGCTATCGCGGCAGCTGCATCA
CGACGTACTTCGACGAAGGGAGACCAGTAAATGATCTCAATCAGTGGGCTCACGTCATCGGCCTCAACGTCTTGACGCCGAAGGCTTTTGAGGACATGGG
CACTGTGAAGAGAATCCCGACGGCGTTCGCCCTGCATGGCATTTAATTCAGCCTCGCGCGCTAGTAGCTGCTGTCGTTTTGGATCAGCTCGAAGAGATAC
CTTTTCAGGCGGGCCAACGGCATCAGCTTTGGTAGTTGGAAGCTGGTGCCCATCGCTAGCTCGATGAAGCTGCGTCGGTTGTGAAATCCTGCGAATTGGC
GGAGGGCTGGCCACGACATTCTGCGGCTCTTTCGTTTTTGAATTCACTATTGAGGAATTGCCGTCTTGAAGCTTTGGCTGCGAGTCCTTCCTGCTGTCTC
TGCGTCCTGCGCTGGTTGGCGATGCTGTAGTGGCGATGGCGGCTCGGAACTGCTCTCGAGGATCCTGCGGCGCTCGAGCAGTTCCGACCTCGGGTAGGAG
TTTGTCACTTGTTGCTACCGAGTGGTCCGTCCTCTTGGACGATGCCGCACGTGGATTCGAAGGGAATAGATCAGTCGGAGGTGCATTCCATCGCCGCTTG
GCGACTGGGGCCAATCCACTTCTAGGCCGGGCAGACAGCGGCTTGGAGGTCAGAGCAGCCGGAGGCTTGGCACTCGTCGCCAGCGACATCTCGCAATGGT
GGAGACACAGGTGCAGCGTGAGACTCCGTCCGCCTATATTTACATGAGGCAAGAAGCTAAACATTGAACTAGTTACCTCCAAAGGCCACGGCGTGAACTT
GGACGACAAACGGATCCCACTTTCACTGCTAGGCATTCTCGCGCACTTGGCATAGACGCACTTGGATGGCTTGGGGGCCGGTACAGCAGCAGTAGCCACC
ACAGTGCTCTCTCACTGGGAGTTAATCGATAGAATATCAACTACTTTGGGAGGAGGCTCCCGTACTCGGCGCCGACAAGACACCGCGTTGAAGTTGTCTC
GGTGGTCGAAATTCTGAAACAAAGTCTAAATTCTAAATCCTAACTGAAACGATGAATTTTGGCCAATCACCGGAAGTCACCCCAAAGGCGAAGACAAGCC
AAGACCAATTTGCTGCCGCCATGAAGAAGAAAGTGGGTGTCGTCCTCCTTGCCCCTGCCTCTGCAGGGGCCATCTACTAACCCACGAGTGCGTCTACTGT
ATCGCGATGCGCGCAGGTTCTGCTGATGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCTATCATCTTCGCCAACTACCTGGGTACGGAATTGCGT
TCGGTGGCTGTGTTGGAGCCCTCCCGACTAACTGAACGATGCGATTTATGTGCCAATTGACTAGCGCGCGACACCATGCGACTGGGACCCACGTGTAGGA
CGGAACTTTGACGATGCTTTAGCCCGTCGAGATACATAGAGAATGACGTTTTCCTGCTTCTTGTAGTGGACGTGGAGCACTCGCACGTGCGATTCCTAGG
CAACTTGGTGCTGAATCTCTGGGATTGCGGCGGGTACAACGACAAGAACTGTTACTGCACTCGAGGCTGAAGCTTGTTCTAATGCTGTGTCGTGGTGTTT
CTTGCAGCCAAGATGCATTCTACGAGAACTACTTCGAGAGCCAGCGCGACCACATTTTCCGCAGCGTGGAGCTGTTGATCTACGTCTTCGACATTGAGAG
TCGCGAGATCGACGTACGTGGAGCTATCGAGGCTGTCTTAGTCTGGCTGCTGATGTTTTTTGTGTGCATTGCAGAAAGATATGGCGCACTTCGACGGCTG
TCTTGAGGCTATCGACCAGAACTCAAGCAACGCCAAGGTGTTCGTGCTCATCCACAAGATGGATCTTGTGCCGGAGGACCAGCGTGAGCGCGTACGTACG
CATTGCCGAAGTTGGGGACAAAGCAAGGTACGATGCTAACGATTTTTTTCGCGGTCATGTGCAGGTGTTCAACCAAAAGAAGGAAATGATTCTGGACCGC
ACGGGCCAATTGCCTACGGTGTGTTTCGGCACGTCTATCTGGGATGAAACGCTGTACCGCGCGTGGTCATCCATTGTGTACTCGCTGATTCCGAACATGC
AAGACCTGGAGAAGCACCTCAACAGCTTCTGCTCCATTTGCAGCGCTGACGAGGTGGTGTTGTTTGAGCGTGCCACGTTCCTCGTGATCTCACACGCTAC
GCACACGAATCACCGCGACATTCATCGCTTCGAGAAGATCAGCAACATTATCAAGCAGTTCAAGCTGAGCTGCAGTAAGACCCAGGCGCAGTTCCAGGGC
ATGGAGGTGCGTAACTCGAACTTCACGGCTTACATTGACTTCTTCACTGCCAACACCTACATCATGGTCATCATGTCCGACGACTCGATCCGTAAGTTCC
AGCATAACTGTGTTATTCTAGCGTTGAAATGCATTTTCATACTAACAACTTGTTTGCCCTGGCGACATTTGATTTGAGTAGAGCCCGCGACGATTCACCT
AAACATCAAGGCGGCTCGTCCTGTGTTTGAAGAACATGTGCAGCAGACGAGCTAAGCTGCTATGATGGTCGATGTAATTGCCAAAGGATGCTTCTTGCAG
TCTCCACCGATTCAGAGGCGCGCTCTTCGGAGGACATAGTACCAACTAACTTGTATAGCTGGTGCTGAACCTAACTCTAATGCAGGAGCAGCTTTAACTT
GACGATTTCCGAGCTTCTTTATTTCATATACGCGCCAAGAGAGCTCCCAGGAACTCCACGCAGCGTTTGTTGGGAAATGCATTCCATGAAGTTTACTGAG
GTGGCGGCGGCGGCGAACCTGACGAATTGGTTGCAGCAAGCATGTACCCTCTGCGTCTCAGCGCACGTAGAACCACGGGCGTGACGGCGAATGTAAGTGG
CCACCGGACGGGGGCCAGCACCTTGTAGATCGTGTAGGCGATGAGGAACGATCCGGCCGAGTTGGTTGTCGAGTCACTCACCGACGTGGACAAGCCCACT
GCATCCAGAATGGACGTGACGTCCACGCCGCTAGAGACTCCCACGTAGATGACGGAGAACGACAGCAGCGACAGCACAATGTGCGTGCAGATCCCCACGC
GGCCGTAGACGACAGCGAACGTCTGGGCACGTTGACGCCACGACTGCGGCTGGAGCTGCTCGTCTCCAGGCTGCTCCAGCTCCTTCTCCGCGTCTTCTTC
GCCCTACACCAGCACAATAACACCATTTACAGTGTCAAACCTGTTGCAGCAGCTTTTCAGATCCCCCAAAGGCAGCAAATCGCACCTTGACGGACGGCGA
CGATGTCGGTTCTCCACCAGTGAGCGGCGCCGTCTCTTTCGGATCCTTGGACGTCCTGCCACTGGACCAGAGCCGCAGCATGCCACAGTTAGCACTGCGA
GTCACAGGGAAGCCAAGCACATGGCGCGACGCAGCGACGGCTGGAGGCCACGAGCAGGAAGGGGCGTGACCACTCTTGCCGCTGCTGGGGATGCTGGAGG
ACAGCGCTCGCGCCACGACAAGGCGCGCCCGCCCGCTGGAAGTCACATCACGCTGCGCCATGCCCCGATAAGCGCCCAAGTACCTCATTCCGCCGCGTAG
CATCATCGAAAAGGACGCAGCGAGGCTTGCAGCTTGATGACTTGGAATATCCACGATGTGGTGTACACCAAACACGACACTTTTCATCCTCCAACTGTCC
CACACCGCGTCTTGGGCACTTGAAGCCATGTTTCGGGCTCCGACGCGCGGCTTCTGGGCGCTCCAGCGTCAATTGCGCGGCGTGTTGGCTGCCGATGCGT
CCTCCCGAATGGGCGCCGGTCAGCGTGCGCTACTCGCCACCACCAGCGAATCCAGAGACTCCGCGGAGTCGACCCACCAGCGACAGCAGTCGTCGTTCCT
GCGCAGCGTCGACCTGAGTAGCCCCGCAGCGCAGCGGAAGCTGTCCAAACTGATCCAGGAGGTGGTCAAAACCAAAGCCAATACCGGTGGTGCGTGCTGC
AAAGCAGTTGCTAGAAGAGGATAGGAGCTCACTTCTTGCTGCTACGGACAGATTTCGTGCCGCAAGTGATCGTCCAGAGCCTATGCACGACGTACCGAGG
CATGAATATCGACGAGAAAAAGCAGTTTCTGCTCATCTTGGCGCAGGACCTACACATTGACACGGCTCTGGTGCGATGGATGGATAGTAGGTAGTATTTC
CACTTTGTGGGACTGACTGGGACTCTTTTGTTTTGATTCTGTTGACGGTGAATAGGTTCTGCAAAGTGCTGCTCAGTTTGAGCAGAACTTGACTAATGTG
CAAGACGCTCGCAGTGGTGTGGTGGGCTGGGAGCACGAGAACGTGGAGCGGTACTTGCGCACGTTTCGCAATCTTCGCAATGCTTTGTCACCACTGTATG
AAGTAAGAGGCATTTACGGGGGCTGAAAACTGGATGGGATGCTTTCGAGGTTTTGTACTAACGGTAGCGACGCTTTCGACGGGGTAGACCTTCTTCCAGC
AAATCTTGTCGCAACGCGAAAACGGAATGTTGTTCTTGGTACACATGCGAGCAGACCTGCTGCAGGTTTTGCGCAAAAACGCTAGCCATTCCGAAATCCC
AGCTCTCCGTTCTTTAGATGCAGGCTTAAAAGTAAGTCTTCATGTGTGTGTTATGTGTGTATTCATCTGGATTCAACCAATTACTCAGTATTCACGCGCC
TTCTACACAGCAATTCCTAGCAGCGTGGTTCAGCGTGGGGTTCCTGAAGCTGGAACGCGTGACGTACGAGCACTCCCCAGGCCAACTTCTGGAAAAGATC
ATTCGCTATGAAGCAGTGCACCCAGTTGGTACAATCGCCGAGCTCAAGCGGCGCCTTGGTACGTCCGTGCAATCCAGAGCAATTGCACTTGAATTGAAAT
GTGACCCGTTTTCGGTTCTGCCTTTGTATTGTACTATGCTAGGCAATGGACGGCGCTGCTTCGCGTTTTTCCATCCGAGGTAAGATCTCGCATACCATCA
ATATTAATATTTAAGTCTGATCATGGATGTGCATGTGTTGTAGTATTCCGGATGAGCCGCTCGTGTTTGTGCATGTAGCACTGATGCAAGAGATCGCCTC
CAGCATGCAGTCAATTCGTGACCAAACCGAGCAATTGGCAGAAGCCTCTCAAACGAAGGCTGCCATTTTTTACTCCATCTCCTCCACGCAAAAAGGACTT
TCGGTAAGGGGTATCGCTTCTGGCATACACATATCATTGAACTGATTTCGTTTATTCCAGGGTGTGGATTTAGGCAATTTTCTCATCAAAGAGGTTGCCA
AAGCTCTCAAGGTGGAGTACCCGCTCCTGAAAACGTTTGCGACACTCAGCCCTCTGCCGCAATTTATGCCATGGCTTGAAACCCAGCGATACAAGACTGA
TGAGTCGCTTGTTTCTCCTCTCGAGCTGGATGCCCTGATCGATGTCCTGGACGAGCGTGGCGTTACGATTCAACCCGATTCGACCGCTGTGGCTATTGTC
CTGGATGCACTCTCTATTGATGATTGGAGCAAGGATGAAAATCTCGTTGCACCGTTGAAGCCTATGATGCTGAAGCTTGGCGCCCGCTATATCTACCACG
AAAAGAAACGAGGTAAGGCACTGGACCCCGTTACTAACTTCCACGTTCGGAATGGTGCCATTTTCGAGCGGATCAACTGGTTGGCTGATCTATCCAAGAA
GGTGCGTGGCTCAGGCGGTTGATCGTTGATGTGCTCACAAAAAAACCTACTTATCGATTTGCGATTTTTGTCCATGACTGCTTCATAGGGCCTCGCGCAA
AGTGCTGGCATGATGATCAACTACAAGTATGATCTAGCACACGTGGAGGTGAACAATGAGAACTACTTGCTGCACAACATCATCCCCATTGGCCTCCAAC
CGCAGCAAGTTCTTGGAGCGCGTACGCTTTAATTGCGTCGCAGGAGAACTTTGTGTAGTACTTGCCAGTAGTAGAGCAGAAAGTTTGCTTGAATTCACAG
TCTCGACACGTAAGGAACGTTTCTGTTTTTTTGTTTTAAAGAAATCGACCAGAGCAGTCTTTTCTGGTATCCCTGTGAAGAGTCGTAGCGCAACGAAGCC
GTGATGGTGTTGGCACAGGATGAGATCGATGCTTGTCGGGAGGCATTCCTGGCTTTCGACAAGGATCGGTGAGGGCATTACAGATGGCCGTGCGATGATT
GAACCTGACAGTGTGCTATTTTACGCTTGGCAGGAGCGGAACAATCGATGTCTGGGAGCTGCGTCAAGTGCTAGAAGGTAAGTGCTGCGCCGGCTCTGGT
TATTCAGGATTTGTTCCAACTAGCGCGTCTTGGATCAGCAATGGGGCAGCAGCCAACAGAGGAGGAACTATTCCAGATGATCAGTGAGGTTGATGAAGAT
ATGAGCGGCGCAATAGGTAACCTTTTAGACGCGACTGCAGCGGATATTGTACATTTAATCCTCATGCCACACCGGTACCAGACTTCGCTGAGTTTCTGCA
GGTGATCGACAATCAAAAGGATCGCGCCGCTATGTTTGAGGATGACAGCGACATGAGTACGGGAATTTCGATTGAGGAGATTGCGGGAGGCGCTCTAAGT
GTCATGTGTGCTTTCGTAGTTGATGCGTTTGTTGCGTGCGGTGGCAAATCCGACAAAACGGGGTTTGTGCGCAAGGAGACGCTCGTGAAAATTATCAAGA
GTGACTTTGGTCTCACTATCAACATTGAGGAGATGATCAACAAGCTAGACGTGGATGGCAGTGGAGAGATCGAATTCGACGAGTTCAAAGCCATATTAAC
CTA