Description :
From Genome Similarity Track
Location :
Scaffold_558:16598- 17953
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_558-fgenesh-gene-0.4Regulator of G-protein signaling 7 isoform D

Sequence
1355 bases(100 bases per row)
TGCTCGAGAAGGGCAACAAGGACATGCGCGAGATCGCCATCGACGATATCATCTCGAACCCCATCTCGTGCGGCTACCTGCTCGACTACTGCCAGAAGAG
CGTACGTGTGCACTTTGCCATCGCCACCCCTAACGCCTTCGTGAACTAACCCGTCGCTGCTGCTCGATAGTACTGCGCCGAGAACCTCAACTTCTTCATG
GCCGTGGACAAGTTCAAGGACGAGTGCGGGCTGCTCGACTTCCGTGACCCCGAGTCGGTCACGACGTGCAAGGAGATGGCTGACCAGATCTGGGCCGACT
TTCTGTCGCTCAACTCGCCGAACGAGGTGAGCCTGCCGTCCGAGGACCGTGCCGAGACGATGGAGCGCATGAAGGCGCCGGGAGAGCACCGCGGCAAGCT
CTTCGACGTGGCCATCCAGGACGCAATCAAAACGCTGCAGCGCGACACGCTCATGCGCTTCCTCAAGTCGCCGCAGTACATCGAGATGGCCGCCAAGGTG
ACCCAGGTGAGCGAGCTGCTCGCCAAGAAGGCGCTCGAGGCCGACGGCGCCTACCAGGTTGACGCGCCGGCCCGGACGACGCTCGTCGAGGACAAGCTGG
CCAAGGAGTTCTCGCTCGACGACATCCTCAACGACAAGATCCTCTTCACCGAGATGCTCGACTACCTCGAGAAGCGTACGTTTGTTGATCACTGCACTGC
CTGCCTGCACAGTTTTGAGGCTGACGATGGATTGTGTGACCTGACCGACTGACAGTTTTCAAGGCCGAGAACCTCAAATGCGCGCGGCAGATCCGGCGGT
TCGAGGAGCTAGCGCTCGAAAAAAAGGCCGACGACCTTAAGGACTTTGCCTGGAACGTCTACCTCTTCTTCATCGCACCCGGTTCGCCCTACGAGGTCTC
GTGCACCAACCTGGACCGCAAGTCTGTGCAGCTGCGACTCGGGTGCCCCATCAAGTCCATGTTCGAGCCCATCCGCGAGAACACGATACTCGTGCTCAAG
CAGGACCACAAGGCCTTCTGCGCGCAGCTGCAGCCCAAGACGCTCAAGGAGCGGCTCAAGGCCGAGCGCACGGGCACCACGGGCGGCAAGTCTGGCGGCG
GCTTCCTCTCCAAGATCAAGGTCTTCAAGTAGGCTGCAAAGCGTCGGTCGCGGACATGACGCGCCGCGCTTTCTATCAAATCCACCTTCCGCTCAGGATA
TCAAAGGTTATGAATAGATACCAATTCTAATGATTGCGATCCGCCATTTTAGCCTTGCATCGAGATATAGAGGCCATCAAACCTCCGCAGCGGCGAACCA
TGAGCCAAGCGACACTGGAGCTCGATTGAGCCTTAGCAGGCCGGTGTCACCCGAC