Description :
From Genome Similarity Track
Location :
Scaffold_465:16595- 18097
Transcript NameFunction/comments
Phymu_g10149hypothetical protein PHYSODRAFT_284815
Phymu_g10150hypothetical protein

Sequence
1502 bases(100 bases per row)
tcgtagCAATTGGACAGTGGCGTGAAGCGAGCGCCGAAACGAGCGTCATTCGGACCAATCAACGGGTGCTGGCCCGACAAACCAGGCATGTTCAGGTGGT
CGTTCATGATCATGAGGTCGCCCACGTTAAAGTCCGGGTTTAACCCGCCCGCGGCGTTGGTCACTAGCAAGTACTTGATGCCTAACAAGTACATGACGCG
GATGGGGAGCGCAGTCTCGCGCATGGCGTAGCCCTCGTAGCAGTGGAAGCGGCCGCGCATACACACAACGCGGAAGCCGTCCAAGTCGCCGAAGACCAAT
TCCCCTGCGTGGCCTTCAACGGTAGAGCGAGGGAACTTGGGGATGTCCTCGTACTTAATGACGTCTTGGTTCTCCAGGCATTTACTGAGACCTCCGAGGC
CGGAGCCACACACGATGCCGATCAAAGGGCGAGTGGTGACGCGCTCTTGGAGGAAGTCGTTGATGACGTCGATGCGCTCCTTCGGCAGAGTTTCGTCGGC
CATTTGACCCGTGGAGAGACGACgcacgtgctgcgtctggctGTTGTCCTTGTTGGCCAGAGAAGCCACGGAGCTGATCGTCTGGCGAGGACTCAGGCCG
TCGACGCTGTGGCTCTGGTGCGGGCGAGTAAGGGCTGGAGGCGACATGGGCTCGGCCTTCAGTGTAGAGCTAGTTGTAGGGGATTTAGGACTGGCTAAAG
TCATTTGCGCTTGGGTGAGTGAATTGGAAAGTGGAATGTGCATTTTAGCACCCGtccagcactgcaacttgcatgTCGGAAATTCGCATTCAGACATGTC
CTGGCTCTGCAAATTGGTATGGCGTCACTCGATTGTCCTGCATGCAGAGTCTGCAGACACTCTCGTGGTTGAAGTGCCGCTAGACACGGTGTCTGACACC
AGCATGAACATGGCGGCTGCTTTCTCTGCGGGGTCCAGAGACTCCTTGTCACATGCTGCGTTTGAGTGGAGCGACAGTGACTTTCACGCGCATTCACGCA
TGAACTGCAACTTTTGTCGTTGTGTCGATAAGCTTCGTCTACAGCTCAGCAGTACAGACATCCATTCCTATATGAAACGTATTTAAAATATAAAATAGCG
TAATGTATTTAAGTAAAAACTGATGTATAGCTTACCTTTGTATGTACATAGTTCACAAATATAGTATTTAAACTTAAGTTTTTGTATTTAACATGTATAC
ATTTACAGTTATTACTGTACTGGTGTATTTGCCAGATTGTTTTCACGTTTGTCATGGCGACAACCGGaccatgttgaagtggcaaaAAGATGGCTACTGG
CGGAGAAAATGCATTTCGGATTATTCCGCAGTGTCCTCCGTCGCGCACACCACTTTGGACGTCGTCTTGGCTTTAGGAGCTACGCTCATGACCCCTCCAG
TCCCGTTCGCCTCGCAGTACCATTTCACCGTTTTCAAATGTGCGTgcgatccagcagcgcaatGCACAGCGACGAACTGGTGCATTTTAACGCCCGTCGG
TT