Description :
From Genome Similarity Track
Location :
contig_67:165945- 167609
Sequence
1664 bases(100 bases per row)
CCAACCTTATGGCGATGGAGCTGACAAACACAGCGCTCGAAAGCAGAACGAGTGTACAACAGTACACGGATGACACGGTCACCGATTCCGGGCAATGGAG
GAAGGTACTCTGCCACCTAGATGGAGACATGATGCAATGGAAAACACACGAGGACAACGCGGCGCAAGCGGACGTCGTGGCCGACAGCCAGTAAGGACGC
CGGCATGTAACGGGGAAGCGTAAGCTTGGACCTGGAGAAGGCTAACTACCGACATAGGGGCGATGATTAGAACAGACATAGGAAGTCGTTAGCACCAATA
AGTGACATCAATGTACCTCACTGAGAAACGAAAACGAAACCATTCGTGGACAGCTCGCAAGATGTATGAATGTAGCCATTCCCCATTATTATAATTTGTG
ATGCTGCTGCACATCGCTCACGTTCTTATCGCTCCCAGTTCTTGGACTCGTACACAGCCACACCCGGTGCCTTGCCCACGCGTCAACTTCCTCGCCTGAC
TGTCGTGAGGACCGAGTCCTTCTTCTCCGCAGAGCGTTCTGCGCAAAACCTTCAGCGTCAGCTTCACACCCTCACGGAGTGTGACTCGGCTCTCCTCTTC
GGCCATGTACTTGGGATGAGTGGTCCTGCTCTTTTCAACTGCAGGCGAGTGGTGCACAGGAGGCCCACCAATTTCCTTCAGATGATCCGCGTCGCCAGCA
ACCGAAAGCAGCAAAACTTACGCTGTGTCACCAGCAACTGAGCAATAATTAGCAGGAGTCACCGTGACGGCACGGATGATATTAAGGGCAACCTGGAAGT
TAAAGCAAGAGACTCTAGTCTACGGTAAGGCTTATCGTACAATGGTCACAAGCAGACAAAAAGCCTGCAAGAGCGAACCCAGGGTATCGGAGCGATCGTG
GTTGGTACTGCACCAACTGTTTGGAAAACAACACACAAACCACTACAAACAGTGGTTGCAACATTACTCAAGTCGCACCAATTGACAAAGTATACGAAAG
AGATGCTCCACCACGACAGCGTACCTGCAACACTTCGGATCCGCATCCAAGACGAGCTGTTGGAAACTAGCAGCGACAATGAGCAACAGAAAGGATTATC
AATAAGGCAAAGCCTCCAGCAATACAAGGACTCATAATTTCTTCGCTAAACACAAATAGAGAACCATTTAACCCCCTGGTATCCAATCTACTTCATAGTA
TTGCTGCCAGCATAGAAGTACTCCTTTACGTGGGCTTAGTGCAGGGGCGGATCTAGAGCGAATTTGTGCCAAGATAGTACAATTCGGCAAGATAATACAT
GCGCAATTTTTCTACCATTAGAAACGAAACATGTACAGCATGCGTCGCGCCTTGCAGACTCGCCCTCAAAACCGCTCCGAATCGGAGTCCGATCTCCTGT
ACGCCTCTGGTTGCAAGTGCAGATGGCACGAAAGAAAAAGCCTCGTCGTCCGTCAGCAGTGATCAAGAGTATATGTCTGTTAGTACCGTATGTTTTGCCC
GACGGATGTGCTCAGTAGTCATGCTATTATACCCGATCAGTAGTTTTTTGTAGTACACTAGACACGTCCGGATAATTTGGCTGCATACCGGTATACAAAA
TAATCACGCGTCCAATCCCAAGCAATCTCTCGCCATCCGGCATGTAGCCATCTGGCCATAAATT