Description :
From Genome Similarity Track
Location :
Scaffold_4:165942- 174063
Transcript NameFunction/comments
Phyke_g442hypothetical protein PHYSODRAFT_284317
Phyke_g443hypothetical protein PHYSODRAFT_476538
Phyke_g444hypothetical protein PHYSODRAFT_343916

Sequence
8121 bases(100 bases per row)
GGCAGGACAATCGATGTGCTGGCTGCTGTGTTTGTGCtatatttttttttctcgtcTTTATTGAGTGTATCCACGTCTTCCTTCCTTCGTTGTCGAAGCA
ACTCTGCAGTTTCTActtgggctgctgctgctgctcctgctgctgctgcatgatcTCGGCATAACTCTCCTGCAGACGCACAGATGAGCGCATCGTGTGG
CGCAGGAACTTCTCCGCGCAGTTGTTGACGCACGACGCctccttgtcgtccagcttcttgctgcggAACGCGTGCACGCAGTCCGAGAAACATAGCTCCA
CTGTACGGCTGAAGTACGCGATTGTCTGCGTCACGCGCATCTCCTCAAtgtgctcctccatcttgcgcTCGAACTCCCGCTGGCTCATCGTGACTGTGAT
CTGCTCGTCTCTGCTTGTCCACCGCTGAATTATGCGCCAGTCGCTTTGGTACAATTTTGGGTTCTCCCCATAAAATGGGAAGCATGTGTACCTAAATCAG
TTGCCCAAAAGGACAATACCCATATTATCAGCGGAAGATATTATCGAAGAAGACTAGAGCAGGCATGAGCGCGACTGCGTGGGCGTCGTGGTTAGACCGA
CTGGAGAGCGCTCGTGGCCAAGAGCAGGTGCTGGCGAACAAGATCCGCTCTGGGAACGCCGCCGCTATCGGCACCAGCGTGTtcgctctgcagcagagtg
TGTCGCGACTCAAACGCGACTTCGACCAGCTCAAGCGGTCTTCCACCACCGCTGTGTACGACTTTTACTGTCGCATTGCAGCAGTTATTACAAACATTTG
TAGGAACTTACTATTGCGCTTGGTGATGGGGACACATATGTACAGGACAAAACAGGAAATAGAACGACGTGAACGATTGCTGGGCCAGTTAGAACAGGAC
CAGGTAGCTCTGAGAGTTTAACCAGCTAttgaagctgtagctgaCGTGGTGGTATGGTGCTAAATGCAGAAAGACGACTTGGATGTGTACAACAACCGGA
AGAACTCCCAGTCTGCTGTGAGGTAGTGACTTATCGTTTGAGGAAGAAGCTATTTACTGTGTGCCCATACTGACTGTTGTGCTGTCTGCAGTCCTGGGGC
GGCGGATGCACCCGCCAGACTACTGAGCATGCAGAATCAGATTATGAAGGACCAggaccagcagctggagTTGATCGGCCAGGGTGTATCCAATCTTCAC
AACTACAGCATGACGGTCAAGGACGAGACGGAGCTCCATGTGCGACTACTGAACGagattgatgatgatgtgtCTCGCGCGACCGACGGCTTGGAGTCTG
AGAGCGCACGTGCACACCGGGTAAGTCCAGAAGGTGGATATTCAAGGCCTTGCTCGACATATGTGCTAACTCTCTGTTGTGCACTGTCGTGCCACCTTAT
TCGTGACACACCCACAGGTGGCcaagcaaagcaacaacacgaaGCTGTACATCTTGATCCTGATCCTGCTAGTGATCCTGATTTTCTTGTTGTTGGCTGG
CGGATAAGCATAAGTAGTCATCTAGGCCAGAGCCATATATTGGCTTGAATCGTTATGCCCTGCGTGACGCCAGCGCTACTGAGTCTTCTGTCGTGCCTAA
TCAAAATTTTCATTTCCCCCAACTGTAGTTTTCTCCATTCCTCTTGTCATGCAACACACTAACAGCAATGGTCACGAAgtagagagagagagagagagta
GAACAATACTACATGTCATCTCGTAGTCTGTGAAATTTTTTGATCCCATCTGACTGTCTCTGTACTGTTAGTTCCCAAATTCCAGTAACGGTCGTATAAT
GGCTGTCGCATTGTGTTGCGGCACTTGCCAGAGCGACCAAGGagagcagcaggtggagacgctgtCGGTCCCCATGGAGAACTCCCGCCCGCAACCCCCC
AGTGccgagcagcaacaaaagcttCGAGAGGCCTACACTTCTCCCATGCGTCCGACGCAATACACGCGCAGTCCTGAAGACCCGTCGGAACAGCAAAAGG
AAATCGTTGAAACCCCTCGAGAAGCCGCCGCCAGGAAAGAACGTGAGCGTCTGAGTATGGAGCAAGTGCTACTGGGCCGCCGCTGGGTCTTCCACTGTAC
CTCACcactcttccatttccaccGTGAACAACTCAGTGAGTACGCGCACGATCTGGTCAAGGCGCTACGAGCCGCGGCGCTCCGAGCTTGTGGCCAGCAG
TTTGGTTACAGTGTGAGTATCCGCAATACAGACACGTTCGTGGCCTTCCAGATTCGAGAGGAGCGTGACCGACGCAATAAAGCCAAAAGACCGACTCTAC
CTGGAGCTCCGACCAAGAGAGAAGCTCCGGAACGCACAGGAGGGTTCGTACTCTACTTCCCTGCTGAAGGAGAGCAGCGAGCGCCACGTAAAGGACGGGA
GAAGCAACAagttttgttgctgcgtgGTAATGAAGAGCTCATGCGGTGGGTTTGTTCCTGGCTGCAACGTCGCTTCCAGTGTGTGGTAAGCACACACGTG
GTGCGGATTCAGCAGCTGAATCTCAAGCGGCTGGCACGTAATTGGGTCGTTGCTAGCTTGATGTCGGAGAGAATGAGACCATCGCAGGTGAAACGTGAAC
TAGATCGACGTGGGAaccaggaagaggaggaagtaTGTGAAGGAGCCATGTCCTCCCGAGAACCGCCACGAGCGCCACTGCAGATCAAGTACCGTGCTac
aaaagaagaagctgttgtgcGTACATACACACTGACAGTCCCGTGGTCTACGCTGCGCCGCTTGCTTGAGCAGACGAACAGCGTTGCTTCAGGGGACCGC
ACGTCTACATATGTACCAGGTACACGGCTAAAACCTGCGTTGTTAAGTGCTGATGTGCTGCTAACTTGTTATCTATTGTCATGTCTATTTTATTGTATCC
AGAGCTCATTGAGTTGACGGAACGACTGTACGTCGACGCGTTGCCAGTCGACCTGTCTACCTATGAGATTGTGGGTGTAGCGATGCAGGAGGTGGCTGCT
GATCCGGATGGAGGTGTCGAGGTGAGTGCTTTTCAAGTTGTATCCATATGTGCTGATCTGTGTGCTGACGATGATTCAATGGTGTTTGTCTTGGACTTGT
CAGTTCTACAGCATGGAGCTTGTACACACAGTGCTTTTTAGTTTGCTGGAGTTACTTGCGGTACAGGATATCGCCACTACTTCGCGCCCGGAGACGACAC
TCTGAGAGAAGACAAACTAGGGTATTGCCAACACCACTGATCGAGCATCAAGACTTGACAACAAAGCACTGCAATTGAACACATGCATGTATCACACCGA
GCATTGTGCTCCTTAGCGCACGTAGCGACTACGTACGTAGATAAACCTTTGACGAAGCCATTTTATTTCAGAATGCGGGTTACTTGTTTTAACATCGACG
ATCACATTGAGCTCTAATGCCAACCAGCAGCTAGATTAGTTGTAGCGACTCAAAtcgagcttcttgtcgaCAAAAGGGAAACCACCGTCATGCGCAGACG
ACGCCTGGGAGTTCGACTGTACCGGTGCACTCGAGCCGGTCAAAGCGAGACGAAGCgcattctgcagcacgtcacGCAATGAAGGCGTCATGGCCGCGAC
TGCCTCTTTAAATGCAGCCGCATGTGTTTGGGCAAAGCACAGTAGTAATCGTGACAGGATCCCAGGGACCTGTTGAGTTGCCGCATTGTCCGCAGTAGAT
GGTGCTGGGTGGCCGAGTACTGCTGCAAGTCGAGGTAGCAGCATGTGGACAAACGCAGCGCCATGTTGGTCATCCAGTTGTGAAGTTAGCAAGCGAAGCA
AGATTTCTGCTCCATCCAACTGAGCAAGCTCCGCAGCCGTTTCGGGATAGCCATTTGATGCACTGACCACCTCCACGAGTAAAGGTCCAAGTGCTACTAG
ATAGCGGTTTACGTTGGAACTTTGGCGCACATCCACAAGTTTCTTCACGACCGCATGCAAACCTCGCATAAGTTCCGCAGTGGCAGatacatgctgctgc
tttttaTCCTCTGTATCTTCTTTTGAGGGCGCAAGAGACAGCATCCCGGAGGATACTTCCGCCATCTCGGCATGGAAGCGtacagcgtcgtcttggaTGC
ACGCAGGCAAATTTACAGCGTAATTGGCTGCGATCTGCAACGCAGATGCTGGCGCAGAATTGATGTCTTCTTTCAGCCACTTGGAGACGAAATTGAAACA
ACTGCGTACGCTCAACTGGATCTCCGCCAACACTTTATCGGAGGCATCGCTATTTGCTTCTAGCATACGTGCCAGTGCAAGTATCGACTCCGTGGAAGCA
CGATGGAGCGCCACCGCAGCTTTCCGTACTGGCGAAGAGTAATCAGCACTCACCAGATCGCGAATTGCCTGCTTTACCATGGCCCCCGAGCGCACCACCC
AGCTCcgtgcttcttcagttgTGTGCAGAAGTACAATGCCAGCCGTAGCGAATTTCACAATTTCTAATACGTGCTTGTCATTTTCGTCGTTCACAACTGC
GAAGCGACGAGATCGCGGGGTTAATGAAATCTGCTTGCTAGATTCGCAAAGTTGGCAGAGGACGTCTGTTGGACACAGGCCTGCCTGGCCGACAATGTCG
AAAAGACCTGCGCGGCCTTCACCGTCTTCTCTGTCGTAGGAACATATTTCTCGAGCAAATTCCAAATTTTCACGTGAGAGACACAAGAAAATAGCCTTGA
GCGCCTCGACACGAGCGGGACCAGCACATCGTCGGCTTGCAAGCATCAACGTATTCACTGCAATAGTTAAAAGCTCGGGAAACTCATTTGACGAGGTACC
GTCACGTTTAGTCGTGTTCTCGGCTGAGGCTCTCAGCAACAACGGGACAGTGCGGAGAACGGGTGACAGCTCGCCGTCATCCTCCATTCGGTCGCGAATG
CTCGCATTCACATGAAAGACCGCGCACGATAGTAGCACAGATGACCACTTGGGTATATTGTCTTCAGCCATGCTACGTGGGGCGATAAGGTCTGGAAGAT
ACACCTCCAGCGCTGCCATAGCATTCACAATCTGTGGCCAGTAGCGCTTGTAGAGCGTACTTAGCATATTGGAGTCTGCTGTAATAGCCATTGGCGGCGT
AGATTGAGGTATGAAAGGCGGTAGAGGTATTCGCAAAGCTGGCATGAGCATTGGCTCATCAGAAAGTAAAGCGGCACTTGAAGACGCATCCAACTGCGGC
CATTGCGCACGACCTTGCATCACAACACCATACGAGAACGTACAATCCATCCAACACTTGAATAAATACTCGATCGTCGCTGATAGACCGTTGGTCATGG
CCTTCACGAGTGGTGAGACAGCGATAACACCGTGTTCATCATCGCGAGTATCCTTCTGAGAAATCGCTTCTCTGATACTCGATGTGAATAACcctgctac
tgctgccaGATTGGCAAGTGATAGCGATGTGCGCGTGACTTCGTCTCCGATGAAGTGCGAGTGCCCATAATCCTGCGTCATTACAGCTCTCAAAATGCGA
CCCAACGCCACTTTATCCTGAGTAAGATGAGCATCGACGCAAATGCCTGCAATAGCATGAGCCTCTAGGAGCAGCGGTGCGTAAAAGTAACTGCGCTCAC
TCTTGTCTACCTCCGAATTGGAAGCAGATGGTGCAGAAGACTCCGCTTGAACTTGCTTGAGAGAGTGCCGGATTGCAGACGAAAGCTGGGCACGATACGG
GTCCAGCAAGTAGGCGTCTCCTGTAGCAACTTCGGGATCACGTGCCGTCGAAAAATTATTTACTAGGATGTTCATCAGGCGGAGACCGACGCACTGAAAC
ATGAGCAGCTCGTTGCCCTCGGCCGACGTCGTGGCAACGTGACATGCCAGGGTAACGAACTCATCCAAGTACATACACACAAAATTTCCGATGTTGGACt
ctgcagacgacgatgggATTGCTCCAGCGGAAAGCATATCGAAGTAATAACGGCGTGCAGCTACCAAATCgaagtggagctgcttgctTTGGCATGCTGT
GCCTGAGATGAGTGTGCTTGACGACATCAACTCAAACACTCGTAACACGCATTCAACTGCAAAGTGCCGCACTTGGCGTGAAAGTGGTGGCATCATAGCT
ACGAGCTCACTGACACTTGCCTTCGTGGTTCGCCACGTCTCTACTTGcgcagcaatagcagcgGATGCAAGCGAGTTTGCATCGGTCCTCGGTAGATCCA
GACCTGGAGACCACGAGGACGCGTCGTCATCTCGCGAGCTACCGGGGTTATCTGTTATTTGTATACCGGGGTTTATGCCTTTCGGGCTCATCATAAGCTG
CtctgcaccagcgccactCAAAAAGGTACTTGCTGACTCTCCGATGGCAATACTGCGACACAGAAGAGCCCACAAGCATGGTTCAGCACCGTCGTGGTCC
CCACCCTCAATGTCGAGCAACGCCAAGAGCGTGCTTCGCAGTGCACCAATACCATTCCGCTGGATAGACGTAACATCAGCAAAAGCAAACGAGAGCACGT
CCCACATACCGTGGAACCCAGGTAAATATACCCACGTCAGGTCGTTGTACTCAACATGGAGCGCCGAAAAGAGGAGGCACAGCAGATTGTGACGATGAAC
GAGGCTGGGGTCTCTCTCGACCAGCGTGCGAATACATGACAGCCCCACGTTTTGTAAAATACTCCGACTCCACCCATTCGTAAACACACCCACGCTAATA
AGACCATTTTGCCCAAACGGCTCCCTTAAAGCTCCAAACGAGGTTAATGAGATCCCACCGCCTGACGGTGGCGACAAAATAGAGGTTCCCAGATCCTGTG
GCGCTGCCAGCGACGATGGCATCGCCGAGTTTAGTAGGGCAGTGTCCGATATGATGCGCAGGATATATCTTAAGTCTGTCGTCTGAAAGCGAGAGGGGGC
AAACACTACCACTTGTTCCAGAAACTTGAAAAACTCCAGCTCAAGTCGTGCATCACCGTTCTGACGGAGAAGCGTCCAAAACGAATAGAAATCGTTCAGC
CGCTCATTTGACCCACCAAGTTCCGGACCGAGTGTTGCCACCACATCGTTAATAATCCTTCCCAGCGCTACTTTCGTGCTAGTTTGCCACCGTAAACCTT
TTTTGTTGACCTTGGAGTATACAAATCCCGCTAACAAATGAGTTTTCATAAGAGAAAATGTCGAGTTCACGTACTGTTCGTAGTCCCCTCCTGTAGAATT
GACGGATTCCAGGATAATGCTCCACGAATGCAAGATCCAAGTGCGCAGTGGTTGTGAGTGCTCACCCGCAAAACGGAAAATAAGCCCGGTGTCGATTGAG
ATACGCGAGCCGCACACGCGTTTAATGCAAGCTAATGCAAAGGCTGCGCCGGCCGATAGAATAGATACATCCAGATCACTGTTGGAACCAAACGTCGCAT
TAGAAGCTCCTTGCGAAAGTTTGTCCACAACCAAacgcttctccagctcgaTTATCAAGCCCTTGCAATGGTCTTCTCCAAGTAGCAGCGCGAGTGTTCC
CAGGGCCTCTCCTGCACCACGACGAACCTCCGAATTCTCACTCGAGATCATTTCACATAGCATGCTttgcatttgctgttgccaagACGTCGTTGACGAT
GGAACCGACGGTACTGATACACCACCGGCTTTTTCAAGACGCTTTCCTTCTGCAATCACCGAAAACAACAGGGAGCATACGTTAACTTCGCAGTCAACGC
GGACATCTGTCAACACTCCAGCATAATGCTGAAGGCACCGTAGTTGTAGGTCTTCCGGTATAAAGTGAAATAGCCGGCCAAACAGGAGTATGCTTGCATC
CACGAGTCGGACGTACGTGAATGGACTGCAGCTCGCTCGTCTGTACACACCATCCACCGCATCTTTTTCATAGACCGACCTCCAAAAAGTGTCGAGGTAT
TGTACCTCTAACTCGGTATCAGTCAAAGCGTTTTCTCGCTGTTGAAGTCCCAGCGAATGATTCAGCTCTCTAGAGTACAGGGGGTTCGGGTAATCACCAG
GAACCAAGCGCGAGAGGGTCACCATGTCAAGCGTGTTGTCATCGGAAGAAAGCACGCTTTGCAAAAAGGTAGATTTTGCTGGTACCAGCGACGAATGCCG
GAGATTTGTCAGCGACTGGGC