Description :
From Genome Similarity Track
Location :
Scaffold_366:16593- 18242
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_366-snap-gene-0.14Myosin

Sequence
1649 bases(100 bases per row)
CAGCGCTTTGAAATGGACAAAATCTACACGTTTACAGCCGACATCTTGCTCTCGATTAATCCGTACAAGACGATCCCGCTGCTCTATGACGTCATGGGGT
TTATGGAGCAGAACAAGGAGCCCGCAGACGCGTCGAAGCGTCCGCCGCACCTGTTTACAATCGCCGAGAAGGCGTACTCAGGCATGAAAGGCGTGATCGC
AGGCACTGGGACCCCGCAATCGATCATCATCAGTGGGGAGAGCGGCGCTGGAAAGACCGAGGCGTCCAAGTACATTATGAAGTACCTTGCGACCGCAAGC
AAACACGCGTCAGCTGCAGCAGCCGCTTCCGCGTCAGGGGCCAGCGCTAGCTCGAGTTCCGCTGCCGCTCACGTGCACGAGAAGATCGAAGAGTGCGTCG
TGCTCTCGAACCTAATCTTGGAGTCGTTTGGGAATGCGAAAACGTCGCGGAACGACAACTCAAGTCGCTTCGGCAAGTACATCCAGATCCACTACAACGT
GGACGGACGCATGGTTGGCGTGTCGATCCGCCACTTTCTTCTCGAGAAGACGCGGCTGGTGATGCCCCAGGCGAACGAGCGCAACTATCACATTTTCTAC
CAGTTGCTCGCAGGACTCAAGGGTTTGGGCAGCACGCAAGAGAAGCAGCTCAAGTTACAGAACGATGTGTGGAACTACACGTATTTGACTCATGGAGACT
GCGTTGAAGTGGACGGTATGGATGACGCTGTCGAGTTCGATCAGCTTCGAAACTGTTTGAGCCAGCTTGGAATGGACATGGCGAGTTTCCAAATGCCGAT
GTTTGAGATCCTTGCAGCGATTCTGCAGCTGGGGAACGTCCAGTTCCAGTCTGTCAAGGAAGAAGGCTCGTCAAATGAAGAAAAGACTGCTGTGGTGTTT
CCCGAGAGTGACCAAGGAGTGGACTTGGCGCATGTGTCGGCGCTTTTGGGTGTTGAGCCACAGGAGTTTGCGAAGAAAATGGTGACTCAGACGACGATCA
CAGGTCGAGGAAGCGTCTTGGAGATCAAACTGTCGGCGGACCAAGCGAAAAATGCAATGGATGCGTTCTGCAAACACTTGTATGGGGAGCTGTTCAATCA
TCTCATCGCGCGTATCAATGCGTGCGCGAAAGAGCACACAGAGACCGCGCAGGAGAAACCCAAAAGCTCCAAGAGTGGCGGCGCGTCAACTGCACCTGCA
TTTATCGGGATCTTGGACATTTTCGGGTTTGAAGTGATGAAGAAGAACAGTTTGGAACAGCTGTGTATCAACTTCACGAACGAGACACTGCAGCAGCAAT
TCAACAAGCACGTTTTCGTGTTGGAGCAAGAGCGCTATGCGAACGAGGGCATCGAGTTCTCTATCGTCGAGTTCAAGGACAACCAGCAGTGTCTCGATTT
GATCCAGAAGCCGCCGACGGGTTTGCTGCCATTGCTAGAAGAGCAAATGCTGCTTAAGCGCAAGACGACCGACAAGCAACTGCTCACGATCTACCACGGA
CAGCACCTCGACAAGCACCCAAACTACACGAAGCCGCGCTTCGAGTGCGACGAGTTTGTGATCCGCCACTACGCGGGCGAAGTGGTGTACGATATTCACG
ACTTCATCGCGAAGAACACTGACAATCTGCACGACGACCTGCTGGACCT