Description :
From Genome Similarity Track
Location :
contig_67:165896- 167465
Sequence
1569 bases(100 bases per row)
ATCGTGGATCGGCTCCGGGAAGTAGAATGGCTACACCACGCCAAAGACGCCAACCTTATGGCGATGGAGCTGACAAACACAGCGCTCGAAAGCAGAACGA
GTGTACAACAGTACACGGATGACACGGTCACCGATTCCGGGCAATGGAGGAAGGTACTCTGCCACCTAGATGGAGACATGATGCAATGGAAAACACACGA
GGACAACGCGGCGCAAGCGGACGTCGTGGCCGACAGCCAGTAAGGACGCCGGCATGTAACGGGGAAGCGTAAGCTTGGACCTGGAGAAGGCTAACTACCG
ACATAGGGGCGATGATTAGAACAGACATAGGAAGTCGTTAGCACCAATAAGTGACATCAATGTACCTCACTGAGAAACGAAAACGAAACCATTCGTGGAC
AGCTCGCAAGATGTATGAATGTAGCCATTCCCCATTATTATAATTTGTGATGCTGCTGCACATCGCTCACGTTCTTATCGCTCCCAGTTCTTGGACTCGT
ACACAGCCACACCCGGTGCCTTGCCCACGCGTCAACTTCCTCGCCTGACTGTCGTGAGGACCGAGTCCTTCTTCTCCGCAGAGCGTTCTGCGCAAAACCT
TCAGCGTCAGCTTCACACCCTCACGGAGTGTGACTCGGCTCTCCTCTTCGGCCATGTACTTGGGATGAGTGGTCCTGCTCTTTTCAACTGCAGGCGAGTG
GTGCACAGGAGGCCCACCAATTTCCTTCAGATGATCCGCGTCGCCAGCAACCGAAAGCAGCAAAACTTACGCTGTGTCACCAGCAACTGAGCAATAATTA
GCAGGAGTCACCGTGACGGCACGGATGATATTAAGGGCAACCTGGAAGTTAAAGCAAGAGACTCTAGTCTACGGTAAGGCTTATCGTACAATGGTCACAA
GCAGACAAAAAGCCTGCAAGAGCGAACCCAGGGTATCGGAGCGATCGTGGTTGGTACTGCACCAACTGTTTGGAAAACAACACACAAACCACTACAAACA
GTGGTTGCAACATTACTCAAGTCGCACCAATTGACAAAGTATACGAAAGAGATGCTCCACCACGACAGCGTACCTGCAACACTTCGGATCCGCATCCAAG
ACGAGCTGTTGGAAACTAGCAGCGACAATGAGCAACAGAAAGGATTATCAATAAGGCAAAGCCTCCAGCAATACAAGGACTCATAATTTCTTCGCTAAAC
ACAAATAGAGAACCATTTAACCCCCTGGTATCCAATCTACTTCATAGTATTGCTGCCAGCATAGAAGTACTCCTTTACGTGGGCTTAGTGCAGGGGCGGA
TCTAGAGCGAATTTGTGCCAAGATAGTACAATTCGGCAAGATAATACATGCGCAATTTTTCTACCATTAGAAACGAAACATGTACAGCATGCGTCGCGCC
TTGCAGACTCGCCCTCAAAACCGCTCCGAATCGGAGTCCGATCTCCTGTACGCCTCTGGTTGCAAGTGCAGATGGCACGAAAGAAAAAGCCTCGTCGTCC
GTCAGCAGTGATCAAGAGTATATGTCTGTTAGTACCGTATGTTTTGCCCGACGGATGTGCTCAGTAGTC