Description :
From Genome Similarity Track
Location :
Scaffold_18:165885- 166954
Sequence
1069 bases(100 bases per row)
CATTGACGCCCCGGAGGGATCTAAGGTCATGCGCTGCGGCTCGGAAGACGTTCTGATCCGTCTTCGGCCGCGGATATGTAGTTGGAGGATGCAGCATGGT
TGATCATCGGCGACGACACAGAATGCATGGTCTGTGGCTTTTCCCCGGTGATGGACTCGACACTGACAAAAAGGTCAGGCGCCGCCGAATATATATATAT
CCAGGTCTCGCTCGAAGATATCCTCCGCATCGAACGCACCGGCCACGATGCTCGAATCTGTAAGCAGGCGTAATAGATCCTTAACTACCATTAGTTTGGT
CGACGTCTTCGTTGGTGCTCTCAACGGCTCCCTTGGAGCTTCGATCTGTCGTGGATTCAGGATCTGCATGACATGGTCTTGAATCAGAACGTCGCGTAAA
GCTTGGTGGCAATATACAAACTCGAGATCCTTGTCTGCCTAGCTTGGTCTTCTTTTTCCGACTCTGGAGCGTGCATTTGCTTCCGCGTAGTCTTACTCGA
ATCGGTCTTCTTTCTCGCATTTTCGACTAGCGGTCCTGGGCTAGGTACGGTGTTGGCGTGACCGGTGAATCTGCAAATGCATACCGTTTCGTCTTCACCT
TCCCTTGTTTTGTTAGCAGATCTTGACTTGCGTCAAGATCCGCAGGGGCCCCCGCGGGGACCTCGGGAGGATAGATAGGTTTCGCTTCAAGATCCAGATA
CGGATCCACCTCTATTCCGTCGACAGAGTTCCTTCCAGGACTCCATCGATCCGCGGAGCTTGCTTCATTCAGCAGCGTCTTCGTCGATCCGACCTGCGAT
GACGCCTCTTCCCCAAGCTCAATCGTCACTTGAGCATCTTCTTGAGCCTCACGCTCAAATCCCGAGGCCGGGCACGCATTATTGTGGTGTAATGGGATTA
GCAAAAGCTGCGAGATTGCTGGATCCAACTTACCAGCATCGCCCAGACACCGACTAAAGGAGGGTGTCCCCCGATGATTCGTGATCTGCTGAACTTTCCT
CACCTTGTGTACCCGTCCGTAGGGCAGGATCTTGCTCTCTCAGCAACTTCCGAGGAGCTCAAGTGGTGA