Description :
From Genome Similarity Track
Location :
Scaffold_19:1658- 7721
Transcript NameFunction/comments
Phyag_g544heme peroxidase
Phyag_g545hypothetical protein PHYSODRAFT_509290

Sequence
6063 bases(100 bases per row)
AGCTGAAATCCCCGATCTCCTATCGCTTCTATGCGTCGGTTGAAGACAATGTCCGACCCGGTCGCCGGTTGACGATGATCTTTCTGGTCTCGAGATCCTA
TTCATTCGCGAACCTCccgcctgcagctcaagctcaagctccagctccagtctcttcttcatcttcacacAATGCTCCGCCGTGCCGCCCTCCGCGCCGC
CCAGCAGgcgtccgccgcctccgccgccagGACGCGCAGCTTCGCCACGTCGCAGCTGCgcaccgccagcaagaacaagcagCCGAGCGCCATCgtgctc
gccgccgccgGCGTGGCAGCCGTGAGCGGCCTAGCGCTGACTGACCTGGTGAACGCGCGCGAGAAGCCCGTGGACTTGGAggccatcaagaaggagatcg
tggagatcttcgacgacgacaactacaTGGGCCCCACGATGGTGCGTCTCGCCTGGCACTCGAGCGGCAGCTACAGCAAAGTGGACAACTCCGGAGGCTC
CACGGGCGGCACCATCCGCTTCGACCCGGAGATCAACCACGGCGGCAATGCCGGCCTGCACTTGgccgtgaaggcgctggagaaggtcaagCAGAACCAC
CCGGAGATCTCGTACGCCGACCTGTACGTGCTGGCCGGTGTGACGATGATCGAGGAGATGGGTGGCCCCGAGATCCCCTTCCGCCTCGGCCGTCCCGACG
CCAAGAGCGGCAAGGAGCCCACGCAGACGCCTGATGACCGCCTGCCCAACGCCGACATGGGCAGCAAGGACAAGACCACGCAGCACGTGCGCGACGTGTT
CTACCGCATGGGCTTCGACGACCGCGACATTGTAGCGCTCGTGGGCGCGCACGCCATCGGCCGCTGCTACCCCACGCGCAGCGGCTACAGCGGCCCGTGG
ACCAACGCCGAGTGGACGTTCTCCAACGAGTTTTTCCGCGAACTGATCGAGAACAAGTGGACGGTCAAGAAGTGGAACGGCCCCATGCAGTATGAGGACC
CCACGGGCAAGCTCATGATGCTGCCGGCCGACATTGTGCTGATCCAGGACCCCAAGTTCAAGAAGTACGTCGAACTGTacgccaaggacgaggaaTTGTG
GTTCAAGGACTTCTCCAAGGCCTTCGTCAAGCTCACGGAGAACGGCGTCAAGTTCCCGGCCTCGGGCTGGCGCCGATTCTTCGGCGGCAACTAGTCGCCC
AGTATTGAGGGGTGGAACCTCCTTGTTTGCAGGAGTTTACTAGCTTCAAGGCTCTGGTAACTCCCTTGCGCCAACACAACGTGTGCAGATCAGCATTTCT
GGACAACCAGAGCTACTCACAGACGTCTAAGTATGAATACAATGACGAAACCGCCATTATTGCTAACCAGACTACCCGTTGTCGATTCTGTCTGATGCCA
TGTTTGACAGCGGATACCTATTTCGGAGTCTCCATGCTTTGCAGATCATGAAGGGAAGCAATTCACGCCGTGGACGGAGGGGGGAGGTGGCGTTGCCCTA
TGAGAAGACTTATCCATGGGAGGATGAACGCGGCACTACAATGGACCGAACGATGGAGGTGAACACTGAGGCCAAGCGTGTATATGCACTTCAGGAAGAA
CTGCTCCCAACGCTAGCCCACGATCGACTACTGGACCCTACAGCCAGCGAACACCTTCAGGATGTGGGGCGTCGTGTTTTGATCCTTCGTGATACGACGA
AGAGGGCGCGCAAGAAGAATGGAGCACAGCAAGGTTCGACCCAGTCCGCGAAACGTGTAATCCCAAGTCGCTTTCCTGAAATCACACCGGActtggatga
agaagatgcaggtGACCCAGATCGggtggaagaggaggaagacccCGTTATCGCTGACGGCCGAATCGTAAGCGCGCTTAGTCAATACTGAGGAGTGTAT
TGTTTGTGGATACTGATGCAGTCCTTGTTGAGGAACTCTAGGCAATAATGCTGATGGATCAGGAATGGGATACGCGAACATGGAATACGACCAAAATTCA
AAGCGCTGTGGAGACTTTATACGAAGAAATCGAGCATTCCGAGGACGATTCGCGACGAGAACTCGCGACCACCATGCTTCTCCGTTTGCTAGAGACTCAC
GAAGGTCGGTACGTTATCTCGTTGGTCAAATTTGATCACCATTGTACTTCTGCACTATCCTCATTGACTTCCGTTCTGGCGTGGTGGGTGGAGCTAGACG
CTGTGGACTACGTGGAAACCTCCTTACCCAGTGTGACCAACAAGGCCTTCCGGACACTCTCAAAACTCACTAACAACACCAAGATTTTCCGCATGGCTCG
GCTTGTAGCAGTGTTAGCAGAGTGGTTCGCGCATGTTCTGTCGAACGAAAACGCGGTGAACAAGAGCATCGGGTGTCTGCTGCGTGAAACCGAACTGTGT
GCGCGTATCCTTCAGCATCATTGGCGCGGAGTACTTTTCGAGCGCACACTCAATCAACGCGACTACGACCCCATCGTGCGAACTCGGTTACGTTCCATGC
ACATGATCAAATtcgtcgagctgcaccaccagTTCAAGGTGTATCGTGACGCTGTTGGGCCCGAAGGAATCCCTAGCGATGTAACGCAAGCATACATCAC
CATTTTGTACCATTTAGTGAAGCTTCGACAGGGGTCTGACGCCAAAACGCGTAACACTGTGCTTTCGGATCAGAGACGTATCCTGGGCTCGGGCTTGCTG
GTATGTCTGGCGTCATTGATTTCGAGGCGTCAAAGTCGTGAAGTTGTCGAGCTGGTGAAAGGAATTGTGTCAAATATCGTGGAAGGCCACGGAGACGAGC
AGATTGTTGAAATACTTCATTGCAATGTCGTGCAGAGAGTGCAATTGGACTTGGTGTACACCATGCAAATTTGTGAGGGGAAAAGCTTAGATGCTGCACT
CACAAGCTCGCTGAATTTGCTGTACTCCATTGCCACAAGGGTGCTCCTGGCGACAGAGAGCTGGGGGTGCCAACCTACTGCTTCGACGCCAGTCAATTCC
TCTGGCCTAAGTCCAACCCACGAGCGATCGCCATCACCTGTGAAAACCCCGTCCAATGCATCAACTCTGGAGGAGCGGAACTTCATGATGCGAAAATTAA
AGGTGTCTGTACGGCAATTCCTACTCACTGCAGATGTATTCGATTCCCTTTTCGAGGTTCTCAGCTTCTGCCGAGATAAAAGTGACACGCTGAGAGCACA
AGTACTAGAAATCCTGTGTCTACTTACACGCTCACTAGGCTTTTCTCAGTTGCTCGATGCCCTTACTCGATGCGGAGGTCAATGGCTCGAACAAGTTTTA
CTGTGCATGCAAGATACCAACCTGATTGTGGTTCGAGCGGCAGTGACTTTATTTTACGAAATGACAAGCCGTACGGATGCTCGGTATGGGCTCACGACAG
CGGGTGCTGTGCAGATTTTCATGCGGTGGTGTCGACCCAGTCTTGAAGCCTCCGAATCGCCAATGACGTTTGTAATGGGGCTCATAGGTTGCGCGCTCCT
AGCTAGGCAAACTGAGCAAGTAAAGCCTGCCACGACACTGCTAGCTGCGCTGGAGACCTTTGAAGACCGGCTGGATGCACTATACACTATCTTTCTGGAC
CTGTCACTGCAAGATGAAACTTTACCGCATGCTTCAGAGAAGACAGCTGCATATTTTTTTTCCGTCAACGCGTTACCCACGCTCGTGCAGTTCCTTACAC
AAGTTTCGCCAAGTTGCATGGAGTCACCAATGCAGAATTCTCGGCAGCGTAACATCAGTTGTATCTTACTCGGTCGGTTGTGCAAAGTTACTCACGTGAC
GCGAGCGTGTTTCTCCGAGGCCGTGGTCAATCACCTTGCGCTTTCAATTCAGTGCAACCGCTTGGATGAAATCGAGGGTTTGGTAGCGCATAGCTCATCA
GAAGATCAATTCGTCCACCAACTAGGCTCGAAAGAAGCTTGTAAAGCGCTTAGCCGACTGGCACGATGTCCAAGCAACATGGTTGACGCTCGCCTTCGCC
CATCGATCACTTCTTCTCAGGTACCAGAATGGCCGCAGGCTTTGATTTGCGATGTCATGTTTCGGATGCACGTGCTTGAAGACCTGATTGCACTCATCCG
AAATCCAAATGATGCCGCAGAATTTGCAGAGATTGAACTTAACAAGGTTGTATCCGCAGTAGAGCTAGTGGGGTACATCCGTCCGCTGCCCTATGGAGAG
AGTACTCGAGATAAGTTTCTGAACACCTACGTGAACCATCCGCACGGGAAGTTTGCTCAAGAAAAActgttgcagcttgtggaaTTGGCTGCACCAGCAA
TTTTGCACGTTCTCCGCGAAAAAAATGCTGACTTCAATGTTGTCAGTGCATGCTGTATAGCACTCAGCCGACTAGCTTGCACCAACGCGGCATGTAGTTT
GCTATTGACTCAAGGTTGCTTACAGACAGCACTGATTCATTTGCCTGAGATTTTGATCGCAACTGGTACGGGAAAATTATCCCCAAAGACTCAAAATGCC
GAGTTTGATGCATCTGTCGATGACCATGGTCTGCTGGGTGTACCTGCCGCATTGTACACGCTTTTTGGTAAACTTTGTGCTGTTGCTAATGGACGAACTG
GGATAATGCGTGCTCAAGTGCTGCCTCGCCTCCTCAAGCGTATGCAATTGCGACATCCAACGTCGCGAGCCATTGACGATGAATGCAAGAGCGAAATTGC
AGTCATTATTTCACGGCTAGCCATGGTGAACGCTGTAGAAGGCAGCACAAGTGAGCTCTTTCTACATTTCAGAGTGTTGGAGTTGCTTACGAAGGTCttg
cagcaacacagaaATCTTGTACTCACTCATAGATCAACGCCATCTTCGTCGAATaagaaggacgaggtgaAAACGTGGAGGCTTCTGGTTCATGCAGTGA
GTGCTATTGCAGCCCTGAGCCAAGATGTACTGATGTGCGTACCACGTGTGGTGTCACTTGGAATTGTCGAGTTGGTGTTCCCATTTCTAACGCGGCTGGA
AGGAAGTTCGAACCCTCACCTCGAGTCGCTACAATACGATGCAGTGACACTTATCCGATCTGTTGCGTCGTATCCGTTCGGCGAATATCACGCATACTTG
GTACATGCCAAGAGTTCTGTTTCCAACGGAGTGTCTTCGGATAATGCAAAGAAGAATACCTCCAACAAAGATAACAAAGGCGTGACAGAGCCTACGACTT
TGGTGATGGAGCGAGTAAAGCAAATTGGCTTTGATTTCGCAATGGAGCTCAAAAACAAACCCATGGCTTTGCGAGACAAGAAATCTGTAGGTGAACTTGC
TCGAGAGACAATGGCTTTCATCAACGAGCATCAGCAgcggcaagagcgacaaCAGGAGCAACGTTGTAAGCCGAGTGTGACCAGCACTACCAAGCTCAAA
GGTGAACACTCCTCCATCGAACCTGTAATGGCGACTAGCCCAATCGTGAAAAATCAACCTCAAACTCGTTCTTCATTTCCTGCTCTACCGAAGTCCCCTC
AAGGTCGGTTAGAAGATATTACCCCTGTTCGATCACCTACGGGGACTCGCAAAGCGATGGGAGTTGGCGGTGCAGTTCTAGAGTCTTCGTCGAGCACCGC
TCCATCCATTCTTGTTCTCGACGGAGGATCGAAATCACCTGCAAGTTTGAATGGAGTAAATCTCGCCTCGACAAGACCTGCTGGGACCAACAATCATCGG
CCGTCTTCCGAATCACCGCAGAATCACCACCACTATGTCTTCACAAGGCCCAAATCTAAGACCAAGGAGCGAGACAAGGACCCGGCTTACTGCTTGATGC
TTGATCCTCTGTTTGATTCGGGTAGCGCCTCGACACGTTGCAGAGGACTACCAAGCGGTAACATGAAGACACCTAACGGCGTGCAGCATCCCAACGGGAA
CGAATATCTTAGCGAAAGCTTTAGATTTTCCCAGGAAGTGGATCACTTCGGGCATTACGTGAACGTGCAGGCGCGTCGTGACAAGAGAGGTGACCGATAC
TTCCCATCCCTGGGTCGGATCGTCACTTCAGACACAACCTTcgcaccttcatcttcagatGCG