Description :
From Genome Similarity Track
Location :
Scaffold_228:1658- 3549
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_228-snap-gene-0.25Anaphase promoting complex protein
Pytar_ATCC12531maker-par_contig_228-snap-gene-0.26Gene of unknown function
Pytar_ATCC12531maker-par_contig_228-fgenesh-gene-0.9Galectin-9

Sequence
1891 bases(100 bases per row)
CGCCGCGACGGAATGAAGCGGTCACTCGCATACACGCGCGTGGGCGACTTGCTCGTGAGGCCAAACCGCTGGCGCTTGCGTCTCGCGATGGCAGCAGGGG
ACGAGGCGTGGACGCCAGACGGATCGAGGAGAAGCTCCTGGTACCATAGGGGCAACGTAGTCGTGGCCACGGGCAGCGCCACGCCTAGCCGTCCCTCGAT
CGTCACCTGACCATTCATCATCGACCGGAAAAAAGAGAAGAATGAGGGCAAAAGGGAGACTCCGAGCTGCTCATCTGAGCCCATGACGGCAAGAGAAAAT
TGCCGAATCGATGGGAGCAACCTCCTCGATTAGAGCGCCTTCCTTCGGCCACCATAACGGCTTTTTCGACCTCAAGAGACAGGAGAACAGCAAGAGACGC
AACGGCTCGCGCAACGCGAGCGTCGGATCTTTGATGGAAACGGATGCGACGCGATCCTCGTACTTAGTCCGCTCCATGTGGTAGTGGAAATGGCTACACT
TCGACGGGATCAGCATCTGGTTGTAGCTCTCGATCATGCATGGAGTCCATGAGGGACGTCTTTGGCCTCCACGCAAGACACAATAACAAGAAGGAATGAA
GAATATAAATGGTTTTGAAGTGGCTATGCGCAAGGCACGACTGACTCGACTGGCCGCTGCGACCGCAACACNNNNNNNNNNAGGGGTTTACCCACTAGGA
GTTCATCCCATGCAGACCAGTGTTGGGCTAGATACGTCTACTTGAAGAACCCGAATCCCTTGTGGCGGCGTTGGTGGTAGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCCATAGTGCATGTGCTTGTGTCCCTTGAACTTGCCGTGCCTGTAGTGGCCATGGTGGGCTGGCGCGTACATGACGCCAGGCTGC
GCGACGTACACGGGCTGTGCTATGGCGTATGCAGGTTGCGGAGGGTACGCGGGCCCAGGCGGGTGCGGGTACGCCGGTGGGTATGCACCGTGAGGTGGCG
GAGGGTACGGATTCGGCGCATGCGCCGGTGGATACGGCTGCTGAGGAGGGTACGGCTGCTGCGGAGGATACGCTGGTTGCTGTTGAGGAGGGTACGCTGG
CTGCGGAGGATACGCTGGCTGTTGAGGAGGGTACGCAGGATGTTGCTGAGGAGGGTNNNNNNNNNNGGCGGGTACGCTTGCTGCTGAGGAGGAGGATACG
CCTGAGGTGGTTGCTGAGGAGGGTAGCCACCAGGCTGCTGCGGGGGGTAGGCACCCGGCTGCTGCGGAGGATACGCGCCTGGGGCTGGCGTCGCCTGTGG
ATATTGCTGGTGGTTCTGCATCGCTGCGAGTGCAGGGCCAAAGGAAGAGTGATGACAGAGAGAGGAAGAAAGAACGAAGAGGAAGAAGGGAGACTTTTGC
AAGGAGCTACGGTTAATCACGAGTAGACCATCATTCTAATGAGTCCATCGCTAAACACAACCCTATCGGAAAGCATCATCAATCCGACGAATCTATCGGT
AAATACCGGTATTCGCTGGCTTCCCAACGTTCCAAATCAGATGCCCCATCACAATCACTCGACTTGGAAGCCAAGAAAGCCACATGAAGGATCTGCGCGG
CACGAGCGCAATCATGTAAGGGGGGCATTTCACGCCACTGCTGTGCAGTTTACTACTGCAGCATTTTGCAACAAAGAAGCTTAGGAGACACTCATCAGAA
TTGCATTCGAACGTGGTTGAGCGGAGCACAGAATTGGTCGGAACAAAACGACACGCTTCTGCTTTACTTGAACATCTTCTTCATCTTCATCTTCTTGAAT
CCCTTCATCTTCCACCCCTTGTGCTTGTGGCCCTTGAACTTCTTGTGCTTGTGGTGCTTGCCGGGCTTCCCGCCGTACATCACCACACCTG