Description :
From Genome Similarity Track
Location :
contig_55:165791- 167274
Transcript NameFunction/comments
g10954.t1RAW35521.1 hypothetical protein PC110_g8184 [Phytophthora cactorum

Sequence
1483 bases(100 bases per row)
TTTCCGAGTCTGCCTGCAGACAAGCAGCAAGACTTTAAGGGGTTCCGCAGCGAGCTTGGCGATATCCTTCGTGACTGCTGCCAGCTGCTGGGTGTTGAGG
CTGTTTTGCAGCACTGTGTGAATGGCTTGAACCAGATTTTCCAAGCACCAACGGAGTCACGAAGTTGGGAGGCCGTGGAGGCCCATTTGTATTGCTTCCG
GTCCATTGCGCGGGAAGTTGAAAAATCGACAGCCAATATGGAGGCTCTGGATGCACCAATTTCGCTTATCTTTCAACACCTTCCGCGGTTCGCTGACCAC
CCTGCAATCTGCTACACATCGTGCCTCATTGTGTCGCGCTACGCTGAATGGTTACGCGCGCATCCCACATCGCTTCAAGCCCAGGTGGGATTTCTGAACA
CCTGCGTGACAACTAGTGCGGGGGACGCAAGATACAAAGAGTGGGAAGTGGCGCGAGCCGCTGCTGCAGCGATTCGGGCACTGGCTATGGACTGCTGGTC
GATGCTCGGAGGGGATATTGTTGCCTTTTACTTACACATCGAGGAGCGTGAGCTCATGGTAGTTGATGACCAAGTGCTGATTCTTGAAGGCATCTGCGCT
GGCGTGGCCAAATCAGGCGACATGCCTCGCATTTTGGCCGTGCTGGATCAGGTTATGAAGGGCATTGGTCAGCGACTGACTGCGCTGTTCACTTTGGCTG
CCGCTAAAAGCCATGTGCAGGTTGCGCTCAACGAGCTTCTGCGACTCATGTGCATTTATGAGTACTTGGACATCAAGAAGCTGCAAGGAGAGAAGCACCC
GCTTGTAATGCTCACGGAGCAATTGTGGCCGCTGTTTAACCAGATGCTAGCGTTGTATCGCGGTCACGATGAGCTCGTGGAACGTGTGTGTCGTTGCTAT
AAGCGCATTCTTCGCACGTGTGGTGCAGAGATTGTTCCTCTGTTACCGCAGCTTGTAGACAACTTGCTGGCGTTCTATCAAGCGGAGCCCAAGTCGTCGT
ATCTCTATACCGCCAGCATGGTGCTTAAGTTCTTTGCTCATGACCAGAGCAAGTCGGCGGAGCTGGACCCCTTGTTCGCTCGTTTGCTTTTCACGCTGGT
GGAGACGACAATTCCTATCTTCGCGAGTGTCGACGACATGCAGACCCGTCCTGATGTGGTGGAGGAGTTCTTTTTTCTCATGGAACGCGCCGTGCGGTGT
GTGCCGCAAGTACTTGCCGCTCCTGTAGCACCAGGGCAAGCTCGGCCGCTTATGACGAGTGTTTTCTCGTGCGCAGTGTCAGCTCTGGCGATGTCACACA
ATGATGCCAATAAAGCTGTGTTGTGCTTTATGGAGCAAGTGTACGTGCAATCCTTGACGGAGGGTTCGCACGTTAAACTTGTATCGCTGTGTGCATCCAA
CAACGCTACGCACGAGGAGAGCAACAAAATGTTGGTAAGTTATCTGCTACGGGGTGTCGTTCTTGGTGCAATGTCACCATCAC