Description :
From Genome Similarity Track
Location :
contig_69:16578- 19337
Transcript NameFunction/comments
g11622.t1hypothetical protein

Sequence
2759 bases(100 bases per row)
GCAATTGGTGTCGGAAAGCCATCGAGGCTAGCCGGCACCCAGCCTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGAACACACGGTATCCG
AAAGGATTACCTGGACGCAATGGCGTCCGCCGACTTAAGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAAGTGTTGAGATACCGTCCACTGCGGGCAATG
GACCGCCACAGGCAATGCCGGTGGACAGGACTAAAGCCCAGCGAGTGGAGCTGCAACGCCAGCAGCACCCACCGCTCCTGATCGTGGCGCCATACAGGTC
TCGACTGTATCGGCGCCAGGGGATGTAAGTCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGTGGCCAGGGCTGAAGTTGCCGAGA
ACACCTAACCATGTGCCACACGGAGTCGATGAGATTCCCGACTCTGTCCTTGAGTCACCACCGGCCGTGGGTAACGAAGAACCACGTCGGGGTAGGCATT
GACGACGTCGTCGCCTTCGTAAGCCGAGTCTGTTGAAACAGACTGGAGTCGCCACAAGCGACTCGGAGTAATCAACGCTCCTCAGGCACGGCCGGCCGAA
GATGCAATCACATCTTCGACGGCGAGACCTGTCAGGTGAAGGCGGCGGTCATAAGTTTGACCGCCCTGTCGGAGGTGTCAGAGTTTTGACACGAGACTGA
GTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGATATGTGCTGATATTTGATTGGCTACTGAAAATTTTGAGTACTGGTTATGCGCATTG
CGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCGCTCAGGCTTTAAGATGCCCCCCCCAGATTTGGAAGGTCAGATTAGGCTCCAAAC
AGCCTGAAACTGGATCTATGTCTGAATAACCCCGTCCTTAAGCGGGTTAACCCAATGGAGTTGAAAATGCCTATGTGAATGTATCACATATGGTGTCCCG
CCTTGCCTAAAGCCTGAGCGTGTGAATGTCCGTGTACCCGGAGTGCACCGTAAGGCACCAGACGCCAGACAAACAAAAAGCCCGTTGAAGAAATGCCGTC
TGGACCCTCACAATGAAGTATGATTTTGGTCATGAGACCTTGATCACATTAGATGTCTGAACGCAGATGTCTGAACGCGGATGTCTGAACGCGGATGTCT
GAACGCATGTATTATACGTGCTCAAGACTATCCCGTACTGTGAGGTCGTACACACTGGTTTCAGCTAAATGTCCAAGTTGAAGAACCCTGAGCGTGAGTT
CGAAGTATCTACGTTCAAGAAATTGGAACCTGAAAATGATGTTCAAGGTCAAGTAACTTGAAAGTAGGTTTAAAGAACCCACGTTCAGACAACCCAGAAC
CCAATGCGAGGATTTGACTCCTTGAAGATGGAAAGTGAACCCACGAAGTGACAGCCAGTATACTCAAGCCAAGTGAAAGTCAGAAGGTCGCCAGGAAGAA
CACGGGAGAACACAGAAGAACGAAGACAGACAGATACACTTTACGAAGAAGCTAGCGATCGGCTAGCAAAGATAACAATCAGAGTTCGTTTAACCCCCTA
CTACGCAAGTCGCTCAAAGTAAGTCTTCTGACAAGCAGGACACGGGTCCGCCGTTCAGTTAAGGGCAGTTCGGTGCGGGGCTCTCTACAAGATTCAAGCC
CAGTTGCGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCTTTATTAGTTGGACCCGCTGCGCGTACGGTAAGGGCGGGGTTTTCATT
TCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATTTGATAGACTGCGTTTGAGATAGGATTGTATTGGTGTGTATTATTTCC
CTCATCTGAGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTATCCTGGAATCAGCCTTAGTTGACTGGTGTTCAGACCCACCGTTCAAGG
GTCTATAAGAATAAGTAACGGCTGCGTGTTGTATATAACTCTGTATTTGTATTGGGTATCTGAAAGCGGTGTTTGTTCCGAGTTCTCGATACCGGTTCCA
GACATTGGAGAAGTGCGTTCAGGAAGTGGACGTTACGCTTAGCATTTCCAAGGCCTATTTGTATTTGACAACTCACTGTGGTGATATATCCGGGCTTCCT
CCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTCAATCACGGTTTCAAGGAACCGCGTTCAGGGTTTACACCCCCCAGGTTTAA
GTTTCAGGACTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTTCATCGACTTCGTCACAGTTTCCCTTTAGGGAATGTCACTGCACGACTTCC
TGGTCAGCCTGAAGGCTGAGGAGATGGTACTCCTGTAACCGGAGACCTCTCCTGAAGAGTTGAACTCTTTTTCTGTTATGGACAGGAACGTCCTGGAAGA
ATTCCGTTGACGTAGTTACGCATAACTACGTCAACAGGTCGCAAGACCATGTCCATCGCGGGTAACCCTCGCGGACCGTCAAAGGCTTAGCCGATGGACA
GGGCGTCTTGCCCGGCATGTGTGGCTGCGCTATACCACAGCGGTCATCGCCGAGAAGTCGTCGCGCCGTACGGCCTTCGACTTCAGTAGTGCCGTGTGGC
ACTACCGGACCGGTGGTTTAAGTCCACGGCCGAGATCGTGGCCAGCTGGAGGTTGCTAT