Description :
From Genome Similarity Track
Location :
Scaffold_138:16578- 19216
Sequence
2638 bases(100 bases per row)
AATTGATCCGATGATGTTTGTAGTATGCGCAGGTGCTGGATCTACAATGCGCCCGGCGGCTTGAAGTTGTCTGTATCGTTGGATGTGTTTGTTTAGATGA
CCAGCTTTGTGCAGCTTGCGCATGGAATTGAGGACTTTTTGTGTTCCGCGGGCTTTGATGTTGTGCTCGCCAAGAAACGAAAGTAACTGCATTTCGGCGA
CATCGCCAAACTCCCACACATCGTCTCGATACTGCGGAGACTTCTCATCAAGCACGAAACCATTAGCAAGAAAAAACTTCACGAATGCAGCGACAAGTTT
GGCGGTGGATTTAGTGTGCTTGCTCGAGCTATCAAACGGAACCAGACGTCCTTCTGGTTTGTTGACGAACTCGTTCGGCGACGTCTGGCTGGTGGTCCTT
TGCTTTTATCCTAACTTCTTTCATGTGTAGTTTTCGGGTGTGCGTTGTTGGAGACCTCAACTTCAATCATCGAGACGCGAGATTCGAGCATTTGGTTGAC
CTTGATTAACTGTTCAATCAATGAAGCTTGACGAAGATATATTGGATGCTTTCTGATGTCGATCGTGCTGTCTTGAGCCTTGATGGTATTTGGTTGCATA
CTTGTCGTCGTGTAGCAGGTTAGATGTGAATACCAAGCTAGAAGATCGCTAACGGAGTGACCTTGATGGATTACACACGCTTCCAAACGTGTGACTACAA
GTCCGTCTTCCTTGAGCTGCTTCAACGATGGATAATGAAGCAGCAGGTAAGTGATAAGCGTTTCAATCACTCTTTCGTTCACGTTGTATTAAATCACCGA
GTTTTTTACATTTGCAAGCGTTGAACTTTTTAGCAAAAAATAATATGATTGCGGATGTCGTTACAATTATAGGTACTTTAGATATTGTATTTGGTGAAAT
TTGTCGTTAAATTGTAAATTAAAAATATTATATTGTATTCTCCAATTAGTATCAGAAAACAACAGCAACGGCACTTTGCGCATTCGAAACGAACGCAACC
AAGTATCAAGACATTGTAAAAGCATTGCATAACACTCGTAGCACATTGTACTTTCCTGTTACACTCCCATACTAAAGTTCGCAAACACTATTGTGTAGTC
ATGACCCCGTGAGATGCATTGAAGAGCGCTGTCGCAACAGTTTGTACTTTTGTCTGCGTACCGGAGTCGAAGACATCAAGTGATAGGAGAGAGATGTTGG
TGTCGGGGTGTCGCCCACTCAAGACCCGGGCAACCTTATGGTCTTCGGAAGCTGTATCAAAGACGTACGTGAAGGCCTTATTCGTCGCTGTCATATTCCA
GGCGCCTCGGTCCGAAGATCCACTGTAAACACGATCCAGCCCCATTTGCATGCTGCGCCCTTCCGCGCCGAAAAGAGTGAGATGTCGAGCGCTCGGATAC
GACAGCTTTCAGTGACTTGATCAAGAACACGGTTGACGTAGCTGTGCACACCAGGAGCGGTATCTGGGCTGTTCTCCTTCTTAGCAGCGGTGGACGGTAT
ATCGGGTGAAGACACCACAACCTCTGGGTGATCGAGCAAATCGATGAGCGGAGTTGCTGGGGCTAATATGGACTGTGAAATAGCCATCTGCTCAGGAAGT
TGACTCAGCACGGATATAGTTGGCGATGAGTGGGTCACGAGGGCGAGCGCTATGGCAAGCAGAGGACATGTGGTGAAGTCTTCGTCAGGGAAGAGTGATA
GACCTTGCTCTTCAGAAGTCTTGATTCGGATGAAACGGACGAAGAATATGTCGCCTGAGTCGATAGACAGGTTAGCCTTCCGCAGCATTGTGAGTTCCGA
TGCACGCCCAAAGTGAAACCAAAGCAGACACAACAACGCCGCATCTTGGTAGTCAGCACTAGTAACCGCAGTTGAATACAAGTAATCCATAATTTTCTTG
AGAGCAGACTTTGTGCATGCTGGGGCCTTGTTCATAAATGAGCCTGACTCACGCTTCATGCAATGGCGTTCGAGGGTCTGTCCCTTCTTGAGCAAATTCT
TTTTAACCACTGCTCGATGCTGTGGGAACTGCTCCAGCAGCCAATTCTTGGCTTGTCGAAAGTACTGCATGACCGAGTGTCGAGCTAAGAGCTGTCTCTT
TCGGCCCTCCTTGAACGCGAGATACATGCCAAACTTGTCCATCACAGTTTCTAAGGCGAGAGGTGCCCTCTCGCGCTGCATGCACTGTCGCAGGTACTCC
CAAGTAACCTCTTCTTCCTCGAGGAACTTCAAAAATGAGTGCGCTGCGTTATCACGGGCACGCTTCGTGTTGGCAGGTGCTAGGTCGGTCAGACTCATTC
TCGGCGGAGATATTGAAGCTTGGATGTTGTTTGTAAAATATGCGATTGAGTTACCTTTTGTCGGAGATGTCAGAGCATGGATGTTATTTTTAAAATATTC
GAATGACTTGGTGTTTGTATAGTGATATCCATGACAGCACTGCTCTCTCCGACCTGATACGTCGGAGAGGTAGCTGCGAAAGCTTTACTTGTCCATCTAC
TCTCTGATTGGTTATAAATATTACCTTTATTTTGACTTGCTAAAAAAGGGTTTTCTATCACTACGCTCACACTATTGGTCAATACAATCAATACGTTATT
CAAGTGCGGTCGAAGACTTAATGCTATTTATCCATATC