Description :
From Genome Similarity Track
Location :
contig_67:165704- 167368
Sequence
1664 bases(100 bases per row)
TCGGCTCCGGGAAGTAGAATGGCTACACCACGCCAAAGACGCCAACCTTATGGCGATGGAGCTGACAAACACAGCGCTCGAAAGCAGAACGAGTGTACAA
CAGTACACGGATGACACGGTCACCGATTCCGGGCAATGGAGGAAGGTACTCTGCCACCTAGATGGAGACATGATGCAATGGAAAACACACGAGGACAACG
CGGCGCAAGCGGACGTCGTGGCCGACAGCCAGTAAGGACGCCGGCATGTAACGGGGAAGCGTAAGCTTGGACCTGGAGAAGGCTAACTACCGACATAGGG
GCGATGATTAGAACAGACATAGGAAGTCGTTAGCACCAATAAGTGACATCAATGTACCTCACTGAGAAACGAAAACGAAACCATTCGTGGACAGCTCGCA
AGATGTATGAATGTAGCCATTCCCCATTATTATAATTTGTGATGCTGCTGCACATCGCTCACGTTCTTATCGCTCCCAGTTCTTGGACTCGTACACAGCC
ACACCCGGTGCCTTGCCCACGCGTCAACTTCCTCGCCTGACTGTCGTGAGGACCGAGTCCTTCTTCTCCGCAGAGCGTTCTGCGCAAAACCTTCAGCGTC
AGCTTCACACCCTCACGGAGTGTGACTCGGCTCTCCTCTTCGGCCATGTACTTGGGATGAGTGGTCCTGCTCTTTTCAACTGCAGGCGAGTGGTGCACAG
GAGGCCCACCAATTTCCTTCAGATGATCCGCGTCGCCAGCAACCGAAAGCAGCAAAACTTACGCTGTGTCACCAGCAACTGAGCAATAATTAGCAGGAGT
CACCGTGACGGCACGGATGATATTAAGGGCAACCTGGAAGTTAAAGCAAGAGACTCTAGTCTACGGTAAGGCTTATCGTACAATGGTCACAAGCAGACAA
AAAGCCTGCAAGAGCGAACCCAGGGTATCGGAGCGATCGTGGTTGGTACTGCACCAACTGTTTGGAAAACAACACACAAACCACTACAAACAGTGGTTGC
AACATTACTCAAGTCGCACCAATTGACAAAGTATACGAAAGAGATGCTCCACCACGACAGCGTACCTGCAACACTTCGGATCCGCATCCAAGACGAGCTG
TTGGAAACTAGCAGCGACAATGAGCAACAGAAAGGATTATCAATAAGGCAAAGCCTCCAGCAATACAAGGACTCATAATTTCTTCGCTAAACACAAATAG
AGAACCATTTAACCCCCTGGTATCCAATCTACTTCATAGTATTGCTGCCAGCATAGAAGTACTCCTTTACGTGGGCTTAGTGCAGGGGCGGATCTAGAGC
GAATTTGTGCCAAGATAGTACAATTCGGCAAGATAATACATGCGCAATTTTTCTACCATTAGAAACGAAACATGTACAGCATGCGTCGCGCCTTGCAGAC
TCGCCCTCAAAACCGCTCCGAATCGGAGTCCGATCTCCTGTACGCCTCTGGTTGCAAGTGCAGATGGCACGAAAGAAAAAGCCTCGTCGTCCGTCAGCAG
TGATCAAGAGTATATGTCTGTTAGTACCGTATGTTTTGCCCGACGGATGTGCTCAGTAGTCATGCTATTATACCCGATCAGTAGTTTTTTGTAGTAGTAC
ACTAGACACGTCCGGATAATTTGGCTGCATACCGGTATACAAAATAATCACGCGTCCAATCCCA