Description :
From Genome Similarity Track
Location :
Scaffold_1:16570- 24029
Transcript NameFunction/comments
Phyta_totarag5dynein heavy chain
Phyta_totarag6elicitin-like protein

Sequence
7459 bases(100 bases per row)
TCGCTACCTGAGTTCGAATTTGCCAGCCTCAATTTCTCGTCTGGAACCTCACCCGAGCTTATTTTGAAGACGTTCTCTCAGTATTGCGAATACAAGCGTA
CTCCCAATGGAATGATGTTGGCACCGAATGCACCAGAGAAATGGCTAGTCGTGTTCTGTGATGAGATCAATCTTCCAGAGGCTGACCGATATGGAACACA
ACGCGTGATCACATTCTTGAGGCAATTGATCGAGCAAGGTGGTTTTTGGTTGGGCGGCAAGAACACGTGGGTGCGGCTGGAGCGTATTCAGTTCGTTGGT
GCTTGTAATCCGCCGACGGACCCTGGACGCGTCCCGATTTCACTGCGTCTACTGCGCCATGCGCCTGTGCTTCTGGTTGATTTCCCGTCCTATCCTTCAT
TGAAGCAGATTTATGGGACGTTCAACCGTgcactgctgaagctgacacCATCTCTTCGGTCGTACGTACAGCCGCTTACTGATGCGATGGTTGATGTGTA
CGATAGCAACCAGAAGAAATTCACGGCGGAGATGCAACCACACTACATCTATAGTCCCCGAGAGCTGTCGAGATGGATGCGTGCGCTGTACGAAGCCATT
GAACCGTTGGAGTACGAAATCGACATCGAAACGCTGGTCAAACTGGTCTTCCATGAAGCACTACGACTTTTCATGGATCGTTTGGTGACATCCGGTGAGC
AAAAGTGGTGCTTCCACATGGTGAAGGAGACTCTGAGGAACCATTTCCCGCAAAGCGCTACAGCTATGGAGGTGGTGGAATATGGAGGTCAACACCCAAT
TTTGTTCAGTACATGGCTTTCAAAGAACTACACTGAAGCCACGACGACTGATCTCCGCAAGCATATTGAAGCCCGCTTGCGCGTCTtctacgaagaagaa
cttAACGTTCAGCTGGTGGTTTTCGATTCGGTGATCGACCACGTGCTTCGCATTGATCGCGTTCTTCGCCAACCGCTTggccacttgctgcttgttggaG
AAAGTGGCGCAGGAAAGACCGTTCTGTCCCGTTTTGTTAGCTGGATGAACGGCATGTCCGTGTTCCAGATCAAGCTCACATCGAATTATACTCTGGATAA
CTTTGATGACGACCTCCGCGTTGTGCTAAAGCGATGTGGTTGTGAAGCTGAGAagatctgcttcatctttGACGAGTCAAATGTGCTTGATTCGGCTTTC
TTGGAACGCATGAATGCTCTACTGGCATCTGGTGAAGTACCTGGTCTGTTCGAAGATGATGAATACACGTCACTCATGCATGCTTGCCGTGAAGCTGTGC
AGCGTGATGGGGTGATTGTAGAGAACACCGAGGACGAGCTTTTCCGGTACTTTACCAAACAAGTGCAGCGAAACTTGCACGTGGTATTCACGATGAACCC
AGCGTCGGGCGACTTCCAAAACCGTACTAACACATCCCCCGCTCTCTTCAACCGATGCGTGGTTGACTGGTTCGGTACATGGAACGATCACGCACTAGCA
CAGGTGGCGTACGAGTTTACGAACACGCTGGATCTTGCTGGTTCTTCGGACTTTGTAATTCCGGATAATGCCGCGGATGTCTTGGCGAAACTGATCCCGC
ATATTGCTACGGGAACGTTCCGTGATGTACTGGTTGGAAGTATCGTTCAATTCCACCATGCTGTCCTGCTCCACATGCGTCGTCTTCAGAAGCGCCATAT
GAAGTACAACCACATTTCCCCTCGGGACTACCTGGAATTCATTCGCCACTTTGTGTCGCTGTATTCAGAGAAGCGTGCCCAGCTGGAggaccagcaactt
cactTGAATGTAGGCGTGCAGAAACTACAGGCTACCCATGAGCAAGTGGCAGAGCTACAAGGTCAGCTCAGTCTTAAagagaaggagctcaagaaaaaGG
ATGTGGAAGCTAACGAAAAGCTCCAGCAAATGGTGCAGGAGCAAAACGAGGCACAAGAAAAAAAGAAGGATACAGAGGCACTTGCTGTTGATCTTGCAAG
CAAGGACGAAGAGATCCGCTCGCGAAAAGAGGTTGTCGAGGCTGACCTTGCTCAAGCCGAGCCTGCGCTTCTGGATGCCCAAGCGTCCGTGAACTCGATC
CGTAAGGCGCAGCTCGACGAAATTCGAGCACTCGCACGGCCTCCTGCTGCCGTCCGAATGACCATGGAGGCAGTAGCGGTGATGCTTGGTGAGTCGAGCC
TGGAATGGGCTGACTTACGTCGTTTCATCAGAAAAGACGACTTCATCTCCCAGGTTGTGAATTTCGACTCCGAAAAACTGACCGCTCGCCAGCGACACAC
TATTCAGGTCAATTACGTCGACAAGGTTGACGAGTTCGACTACGAAAAGGTCAATCGCGCATCGAAGGCGTGTGGTCCATTGTACAAGTGGATTGTCTCG
CAGCTCAGTTACACGAATATCTTGCACAAGATCCAACCGTTGCGAAACGAGGTGCAGACCCTGATTGACACGTCGTCGGATCTGCGTGCGAGATACGAGC
AGGCCAAAAAGACCATTGACGCGCTCGAGATTCGCATCGAAAACTTCAAGCACGAATATGCGGCTTTGATTAATGAGGCGCAATTTATCACGAACGGCAT
GGCTTCTGTGTCGAAGAAAGTGGAGCGTTCTGTGGCGCTTCTGAAGAGCCTGCTGCAAGAGAGTGAACGATGGGAAGCTGGCTCTAACGACTTTGACACc
cagatgaagacgctcgTGGGGGACACATTATTGTCCTCTGCTTTCCTCACGTACATCGGTTTCCTCGATTTCCAGCAGCGGAAAATTTTGGTTCAGGATT
GGCGCGACATTTTGGACTCAATGGGCATCAGCACGAAACCGCAGTTGAGCTTCGTGGATTATCTGTCGCGCCCGAACGAACAGTTGGAGTGGCAGATGAG
CGACTTGCCCTCAGACGAGTTGTGTTACGAGAATGCTATCATtctgcagcgcttccaccGCTTCCCGCTGATCATCGATCCTTCTGGACAAGCGAACAAT
TTCATCATGAAGTACTACAGTCTCAAGACCAGTACGAAAATTGCACAAACGTCGTTCCTGGACAGCTCATTCATGAAGGTGTTGGCCAGTGCTATTCGCT
TCGGCACTGCCCTTTTGGTTCACGAGGTGGAAAACATCGACCCGATCCTGAACCCTGTGTTGAACCGAGAACTTTACAAAACGGGTGGTCGCGTTTTGAT
TCGCCTCGCTGGCGAGGAAATCGACTACTCGCCGGACTTTCGACTCTTTTTGATCACGAGAGATCCATCGTGCCGTTTCTCACCCGACATTTGCAGTCGT
GTGACTTTTGTCAATTTCACAGTCACCCCGAGCTCTTTAGAGAGTCAGGGACTGAGCATTCTTCTTAAGAGCGAACAGCCTGAAGCAGAGGAAAAGCGCA
ACAATCTTCTGAAGTTGCAGGGCGAGTACCAGgcgaagctgcgcgagctaGAGGActctctgctgcagcaaatcAACAATGTGCAGGGCAACATTCTAGA
CGACGATCGGGTCATCAATGCTTTGGAGAGTATGAAGGCGGAGGCTGCCCAGATCTCGCAGCAAGTGGCAGAAACGGAATCTACCATGGCAATTGTGGAG
GCAGCGACAAGTCGCTATCGCCCACTCGCAAAGGCAAGTTCACGTTTGTTCTTTTCGCTGGAGAACTTATCATCGGTTCACTTCCTTTACCAGTACTcgc
tcgacttcttcctATCCCTGCTGTCCAAGGTATTGGCAAAGCCGACTGAAGGAGGAGATTCGGCTCGCCTTGCCAGCATTTCTACTGAGCTCTTCATGCA
GCTTGCTAGGCGCGTGAGTAGAGGACTTGCCGAAAACGACAAGCTCATGTTTGCGCTCCGCTTATCTCAAATTTACCTggagctggaacagcaaaGTGCT
GCAGTCGCTAACGCTAAGACGACTATGGATGATAGTTCTGTATTTGATGGACCTACTGATGAGGATATGGACATGCTTCTTGGAAGCTCATCAACCTTGT
TCAAGGCTGATAGCGGTGCACAGCGCAGTGAGCTTGAGCAATTGCTGCCGGCTTTCTCGAAGACTGAAATGGACcagttgttgaagttggcgaagCTGTC
GACGTTCAAACACTTGGAGACGCACGTGCGTGAGCATGCTGCTGAATGGAATACGTTTGTCAAGACTCCATCAGCTGAGGAGGCTCTTCCAGCTGATTGG
GATGCGCAATAcgcggcagcttcggcaaGTCCACGTCTTGCTGCGTTCAGAAACATGATTGTTATCCACTTCTTACGGCCGGATCGTATCATGTTTGCGT
CGGAGCGATACATCGAGCTGGTGTTCACGGCGTCATTTCCGTGGCGTGGTGAGATCGAGCTCTCCAAGAacgttgaagaagacacCCAGGCAGCCCGTGG
GGTGCTTTTGTGCTCAACGACGGGTTTCGACCCAAGTGCGCAGATTGACGAGCTTGCGGTGGCCCTGCAGAAGAAATACAACTCAGTGTCCATGGGTTCA
TCGGAGGGTTTCGATGCGGCCGAAAAGGGTCTGAACACCGCTTTGAAGCACGGCTCCTGGCTGTTGCTTCGCAATGTTCACTTGTGCCCGTCATGGCTTG
TAagtgtggagaagaagctctacAACGCGCGTGAAAGTGTGCATCCGAACTTCCGCCTGTTCCTGACGAGCGAGATTAACCCGAACTTGCCGGTGAATCT
CGTTCGCATGTGCGATATCTTTGTGTTTGAACCACCCAGTGGCATGAAGCTGAGTATGGTGAGATCACTTGATACGGTGGCAGCTGAGCGCATGAACCGC
TCACCAGCTGAACGTGCTCGCCTgtacttgctgcttgcgtggTTCCACGCTCTGGTGCATGAGCGACTGCGCTTCGTACCAATTGGCTGGTCTAAAACGT
ACGAGTTCAGTCAGTCTGATTTCCGTGGTGCTTGCGATGTGATTGACCGCTGGGTGGACTCGGTAGCTCATGGCCGCGCGCACGTTGCCCCCGATAACAT
TCCGTGGACAGCGATCCGAACTACGCTGAAGGAGTCGGTTTACGGTGGTCGCGTGGACAACACGTTCGACCAGGAACTGATGGACACACTTTTGGAGCAT
GTTTTCACGGCAGCCAGCTACGAGAATACTTTCGAGCTTGTTGCGACTGGTGAAGGCAAGGGTACTGGACTGGTGATTGCAGAGGGCAAGACTAAGGCGC
AGTTCATGGATTGGGTCATTGCCCTCCCCACGACCAACCCACCTTCGTGGATGGGTCTTCCACGCTCGGCGGAAACAATGGTGCTCATCAGCCAAGGTGC
GCGCATGCTGCGTAACTTGCAGATAATGCAAGACTTCTACGGAAGCGAAGGCGGAGACGATAGTGCTGGCGCAGACGATGATAGCAAGATGGTTCTgggt
actgctgctgcagatggcgaagatgcGCGGCCCAAGTGGGTTCAGGACCTGGACCGTCGTGTTGGCACgtggctggagctgttccCTTCGGAGGGACTTG
CCGTGCCTACTGTGCGCGATCCAGTGCACTTCGGCAACCCCGTCTACCGCTGCATGTTCCGCGAGCTGGAACTCGGAGCAAAATTCCTGGGCAATGTGGG
TGGTTTGCTACGAACAGTACAGCAGGTGTGTGCTTACAAGGCCAAGCCTTCTAATGAAACACGTGAGGCCATGCGAACACTCTCCCGAGAGCAGGTGCCT
GAGCAATGGAAACAACTATACCGCGTCTCTAATGAGCTTAGCTTGAGCGAGTGGCTTACGGACTTCTCACGACGCGTGCACCAGTTGAAGGAGTTAGCAC
AGGTCGCTCCGACGGACATTCTGCACCAGTCTGGTGGTATCTGGTTGGGCGGATTCTTCTCGCCTGAGGCTTTCGTGACGGCTGCACGCCAAAATGCTGC
AGCGGATCTTGGGTGCTCGCTGGatgagctgcatctgcttgcCGATGTGGAGGATCCTTCGGCCTCATCAGCTGGTGGTTTTACCGCTCGTGGACTACTG
CTCGAGGGTGCCACCTGGAACTTCACCGGCTTTGCGCCGTCGAACGAAATCCGCAACAGCTTGTCGGCTTTGCACCTTCGGTGGGCTCCGCGGAGTGTGG
AAACAGATAATCTCCGCCTGCTTCCGGTGTACTCGAACAGTAAGCGTGAGACTTTGTTTTTCTCCGTGGCGGTTAATGCTGAGGATTCCGCTTTCCCGAA
AACGCAGTGGGTGCAGCGCTCTGTGGCACTTGTGCTTTGGGAGTTGCAGACCTAGATTTGGTGCTGGAACGACGTTGTTTGAGTCAGCAACTGTCgagtg
tttttttttcataTTATCACATCGTAGTGTTCGTGTTTGGTAGGCATGGCGTTGACTTAACTTGATCAATAAACCCAAAGCCTACCTCATATCTGTCTCT
TCCTCTGACTGAATACTACTAACGTTACTTTGTTTTTGTCGCTGTCTTGGGTTGTTGACCCGTGTGTCGCTTTGAGTTGTTTGTGTAGCTTGGTAATGCA
GAAGCTCAACGATTGAAAAAGACATGGGTTGCATGTACTTGGTCATGCAGtctcttctcttcttcgcccCCTTCATACTCGTTCTCCTCAAAGAATACTT
AAAACGAATCGCTGCAATTCAAAGCGAGAGCTCCTCGGTGCCAACTTactcattctccaatttgctTCCAAGTTGGCACCCGAACACTCAAACCCAAGCT
CTCCCGTCTTTCTCAGCATCGACCTCCAAGCAACTATGCAGCTcggcattttcttcttcttcctgctcacAGCctatggagctgctgccgaagaCACCTG
TCCTCCGACCGAGGTCGTGAAGTTCGCTGAGCTTTATGCCAACCCGCATCTGCATCCATGCCAGAAGGTCTCAGCCGGCTTTTCCATCGCTCCACCTATG
GGCTACCCCACGGACCCTCAAGTCAAGGCCATGTGTACTTCCGACGCGTGCCGTGCGCTGATCAAGGATGTCCTCGTATTGAAGCCCGCAGACTGCTACC
TGTCTTTCGCCGgtgtgaagctgaacgcgTACAAACTCGCGAACAGTTTCGAGAATGCTTGCGAGGCTGGCACGGACAAGGATCAAGAAAGCGGGGAGTA
TCGACCGACTCCGAAGCCGACAAAGTACAACGAATGCTACCACACACCGAAGCCGATGGGCGACGCTAAGGACGATTTCGAACTGGAAGAGCCGATGATT
GTCAAGGACGACAATGAAGCACCCTGCCCGACACACTCTGCTGGAAAAGAAAacgcaaaagaagaagacgagctgaAGCCACCGATGAATGGCACGGCTG
TCGAACTCTTCCCGATGCCCAACACGACGTACAAGGCAGAAACCTCGTAGGCAGTTGCCCACCTGTGGTGCTCAAATGGCAACCAccgacttcatttcac
tcAAGAATTTCAAGTCCAGCGCTGCTACATACGCCAAAGCTCCCATTTAATCATAATGG