Description :
From Genome Similarity Track
Location :
Scaffold_573:1657- 4508
Transcript NameFunction/comments
Phyta_totarag9361hypothetical protein
Phyta_totarag9362hypothetical protein PHYSODRAFT_330962

Sequence
2851 bases(100 bases per row)
CTAGACATTTATGAGCGCGAAATCTTGCAGAAGCAAATTGAGGAAGAGATAAtggcgaggacgaaggcCTTGAACAGACAGAGCTCCTCAACTTTTCTGC
AACAAACCAACGTGGCAAATATTCCGCTCGATTATCAGGGATTTGAGGATGTGTACGAAGAGGAAGTGGACCCAGAACGTTTGCAACtggagaaagaaga
agaagaaggcgctcgcATGACAATGCATTATGAAGAGGCCCAACAGTGTCAGAATGGAGATAGCTTTTGGGGTATCCAAGCGGAGGAGTCTAGGCAGCAT
GCAGCGAATATTGCTATGGCTCAACAGGAGGCAGCGAGCCGCCGTTTTGCTGAAAGTGTACTTGAGCAAGCACTTAGTGCGACATGGGAAGCTGAAGTAC
AGCAAAATGCAACAAAAGAAGTAGCTGAGCGAGGTGGGCTGGAACAACGTACGCAGGCGAGATATCTCCACTGGTTCTATCGGCAGTGTGTTTCGGTTGA
CGAATTGCTACGGTACCGATGGCCGACTAAACAACAGCAGGAGCACCTCGAAGGAGCATCGTCACCAGTCaaaagacgacgacaccCAGTTGTTGAGTCA
GTCCCAGACTCTGTTGCTTCAGCGACGCCATACTCGCTGGATGACTTGGTGGTTCGCGAGCGGTTAGAGCACGGAGATCTACGCTACGGCTTTCGATCCA
TCTTGACTGTTCATCACCAGGGCGTTCGCGGCACACACGGCACTCATTTTGAGATTACACAAGCCCCTCCAGAGTGTGCTTTCGATGAAGTcacggctgc
agcactctTGAAAAGCCAAATGCTGGTATACTCTTCCGATCAGCAAATGAACAGTGAAGAAGGATCGTTGGATGATATCGAGCGCCTGGACAGCCGTACC
AGGGACAGAagtcaagaagaagaaacaacaTCAAGGTCTTCAGTCAACTACCGTCGCTATCGGGTAAGAACCCTTGTTTGCTACTACCTTTGTTCATGTT
TTAACCCGCGGTGCTGTCCCAAGCAGATGCCGGATCCTCATATTCCTGCAAGATTTAACGGAGTTCCGTACAAACCAAACCAGGTGAGGGAAGGACCAAA
TTATGTCTTCAACATGGTACAGTAAACTTTTGTGCTAACGAGACATACGCTTACAGATAAGCCCTACTCGTGAAATTCTAAGTGGGGACCATCGAAAACT
AAACCAGCTCCCATCTCTCAACAAGCTAAAGCCCTCAGCGGAAGTACCAAAGATTCGTCAATTACAGAAGGCAAAGATTAAAGCACGAGCAAGATTAAAA
GTCTCAGGAGCATCTACACAGCAGATATCTAACAGCGGAAGCAATTCCAGCTCAGCTCGAGGACGCGAGGCGGACGAAGATACTGACACAACTGACGGAG
ATCCTCGTACTCAATTCAGACGGCAGGAGCACGAAGTATTGTCAAAGCTTTTCGCGCTCATGGACGTGGACGGAAGTGGCACCGTGAACCAGGACGAGAT
GAGGTGGGCCCTACAGCGTGATGAAGAAATACATGCACTTGCCAAGACTTCACCGCTgcttcgcctgcttctcAAACAGCGTACCCACCTGGAAGCCCTT
TTCTCGAGCCAAGCCGTCGAAGGGCTATCCGATTCGGATACTTCTCGAAGTGAGAGCAGTCGCGAGCTGTCCTGGGCTGAATTTCTAGCGAGATGCGAGT
ACTCGTACCTCCGTCTGATGTCAGAGGGTCTCATCCAGCCTGACGTCGTTGCCTCAACAACCCGCTCTCGTGAAGTTCACACCAAAGGGGCTAGCAATTT
CAAGAACAACTACCACGAATTGCATCCCGAGCTATCGGCGAGAGAAGCAGAGGCACAAACAATTCGACGCGTCttcgcgttgctggacaGTGATCGTAAC
GGTGTAATTGACGTCGCTGAAGTCCAGCAGGCCCTCTACAACTCGGCTGCCACTACTCCAAAAAGTGATTCTAGACCAGGAACAGCATCTAAGGAGCTCC
GTGCTCTAGTGGAAGGTTCTAGGGCACTGCAGCCGATGTTGCACCAGGAGCTTTTCATGACGGCATTTACTAAGTTTGAACCTTTGGACCCACGAGGGAT
CAGTGAGGAAGAATTTGTGGCCTTCTGTCTCGAGATTgctcacgttgctgctgccaacaacatGGTGGCAAGCGTTGGATAGAAGACTGAAGGCTGCTGG
CTTGGTCAGGTCGAAATGGCTCTTGAGCAGCCAAGAAAATTGTTTTACTCTGTCAATTACTACTACAGTACATAGTAGTGTTTGTGTTATACAAGTATCG
ACGTCTTAGCTTTGAGCAAAGGCTCTAATACGTTAAACAGCGCAGTGACTGCGAGACGTACACGGGCTTTGTTCTCAGGATTTATACACCCCGTTGTAAT
CGGATAGAATATGCAGCAGGGACCACTTCGCCACGCAATCATATCTGTTCCTGCTTGTTGTCCTTTTGCTGAAGATGCGCCAGGAGCATTTTTCCAGACA
AATTGGCCGAGCTGCGGTCGTTGCTGGGCCGCTTTGGCATTTGAAATTGTAGCTAGGAGTGATAACCCCGATACTTCTACAAACGGAAGGAGTACGTCTG
CGATTCCGTAAGCTTTCTCTGCTTGGTACGGCTTCATCAATGTTGCTTTCTTTTCGTGGCACTGGATCTGGATCACTCGCTTAAATTCGTGCGGCTCTGA
GTGATCCAGGACTGCATTTCGAGATCTCCATcgagtcttcttcttcttcggttttttctttttgttgCTCTCGCACTTGATATGTGCGCCAACAATCGCT
CGGGTAGATGCCATCATGTTGCGAAGACTGAGATTTTGCGCACTACTTCGT