Description :
From Genome Similarity Track
Location :
contig_67:165655- 167224
Sequence
1569 bases(100 bases per row)
AGGCACGGCATTTAACACAAATCTACTGGAAGAGTCGGCGCATCGTGGATCGGCTCCGGGAAGTAGAATGGCTACACCACGCCAAAGACGCCAACCTTAT
GGCGATGGAGCTGACAAACACAGCGCTCGAAAGCAGAACGAGTGTACAACAGTACACGGATGACACGGTCACCGATTCCGGGCAATGGAGGAAGGTACTC
TGCCACCTAGATGGAGACATGATGCAATGGAAAACACACGAGGACAACGCGGCGCAAGCGGACGTCGTGGCCGACAGCCAGTAAGGACGCCGGCATGTAA
CGGGGAAGCGTAAGCTTGGACCTGGAGAAGGCTAACTACCGACATAGGGGCGATGATTAGAACAGACATAGGAAGTCGTTAGCACCAATAAGTGACATCA
ATGTACCTCACTGAGAAACGAAAACGAAACCATTCGTGGACAGCTCGCAAGATGTATGAATGTAGCCATTCCCCATTATTATAATTTGTGATGCTGCTGC
ACATCGCTCACGTTCTTATCGCTCCCAGTTCTTGGACTCGTACACAGCCACACCCGGTGCCTTGCCCACGCGTCAACTTCCTCGCCTGACTGTCGTGAGG
ACCGAGTCCTTCTTCTCCGCAGAGCGTTCTGCGCAAAACCTTCAGCGTCAGCTTCACACCCTCACGGAGTGTGACTCGGCTCTCCTCTTCGGCCATGTAC
TTGGGATGAGTGGTCCTGCTCTTTTCAACTGCAGGCGAGTGGTGCACAGGAGGCCCACCAATTTCCTTCAGATGATCCGCGTCGCCAGCAACCGAAAGCA
GCAAAACTTACGCTGTGTCACCAGCAACTGAGCAATAATTAGCAGGAGTCACCGTGACGGCACGGATGATATTAAGGGCAACCTGGAAGTTAAAGCAAGA
GACTCTAGTCTACGGTAAGGCTTATCGTACAATGGTCACAAGCAGACAAAAAGCCTGCAAGAGCGAACCCAGGGTATCGGAGCGATCGTGGTTGGTACTG
CACCAACTGTTTGGAAAACAACACACAAACCACTACAAACAGTGGTTGCAACATTACTCAAGTCGCACCAATTGACAAAGTATACGAAAGAGATGCTCCA
CCACGACAGCGTACCTGCAACACTTCGGATCCGCATCCAAGACGAGCTGTTGGAAACTAGCAGCGACAATGAGCAACAGAAAGGATTATCAATAAGGCAA
AGCCTCCAGCAATACAAGGACTCATAATTTCTTCGCTAAACACAAATAGAGAACCATTTAACCCCCTGGTATCCAATCTACTTCATAGTATTGCTGCCAG
CATAGAAGTACTCCTTTACGTGGGCTTAGTGCAGGGGCGGATCTAGAGCGAATTTGTGCCAAGATAGTACAATTCGGCAAGATAATACATGCGCAATTTT
TCTACCATTAGAAACGAAACATGTACAGCATGCGTCGCGCCTTGCAGACTCGCCCTCAAAACCGCTCCGAATCGGAGTCCGATCTCCTGTACGCCTCTGG
TTGCAAGTGCAGATGGCACGAAAGAAAAAGCCTCGTCGTCCGTCAGCAGTGATCAAGAGTATATGTCTG