Description :
From Genome Similarity Track
Location :
Scaffold_65:165603- 172631
Transcript NameFunction/comments
Phyca_LT1534510710PREDICTED: myotubularin-related protein 13-like isoform X2
Phyca_LT1534574789Hypothetical protein
Phyca_LT153434721ATP-dependent RNA helicase dbp4, putative

Sequence
7028 bases(100 bases per row)
cgtacggcgttaagattgcgatgaaatacttggcgaagaacgcgcaatttcccatcaatggctgttccgacgcagaaaatgattgtgacgaacctccgat
cgtggactccaataagctgcgctgtattaaacgtgacctggcggctggcggagaagacgcactacggacgttcgatgacgttgccgtgaaggtgaagcga
gtcctgatgtttaagtttccggaatttcgcaagacggatctgtatactgaaatgcagaagactgtggagcgggaagttatctgccttgaggacatcctga
tgaaccaccgtttcgccaatttcttctggatcttcctcttcccgcacaattaccaccgcgagattgcgctgtggctggacgttgagtatgagttcaagcc
ggcgttccgcgtttatatgtcgctgctcaagtctagtggcggctctcgagccacctcatccagcagtacaactagcaaccagcgtcgtgagcgcatagag
caggctgcttatcgatgcagaaggttgctcaagtacatttcacagaaatactatgccggagatgctgagatgcagacactgtcccgcacgctagtgacgt
cctgttcaagacttcaagctgagcaagatgcgatcttgacgaaatttagtctcattcacttggaactgtatcaccgctttctaacgagccgcgcgtacgc
cgagttcgcactgtatccgaagctttcacctgaagacgaaaaggactcgatcgacgactccatgagactttcggcgctgcttttgagctacggcttgcgt
gcgcatcactgggctggtggaagttcaagttcatcgtcacctaacggctccacatcgtcttcgtcggccagttcacgtgatgctgaagctacagcgccga
agaagaaaacgctggactcgctacgtacggcacggagtttcgaagccatctcaggtgtcctaacgttcgaagctgtatctgtgcctatgacagccgaaga
cgcagaagctgccgacgagagcagtggggtcttcgatgacccgatcgaattgcaggtagtgcagcatccgttgcctcatgacccggcacctcacatagtg
gataaatccgtcgagaacttccttgtgccctggagctcagaccccaagcatgtggtgcttacagcgccatcttgccctgcacctctggcgtttaactttc
gcatgggagacagtagtgctggtgcatcggctgccgaattgttcgcagcctgtgtggttttgtataagccagcacccccactatcaagacgagcgcttga
gagctcgcgaattgattctgcaggtggttgccgatgggttccttacggagtgtgtgtgctgtccaagtttccgatggtggatctcctccgagagcgtctt
gctgaagcgtacgagtttatccttgagcttgagacgattgctgctgcagctgctgccaatggtgacgtgaagggggctcttcataaagctgaacatggct
ttcagctagacaagaaggttcttgccaagctgacgcgttccgtctcaaaagaacacatttcacagtaccaccagccatcgccactgccagagtcaccttt
gctcgaggcctcaggtttgacacctaaagcgacagctgcctcgctgcttgccgctctcccgcgtttggatcactctgtgcgcctggtgtttgatacgttg
gacgtctccactgtcctacttgtgtttactgcagcgttgttggagaaccggattctgttggtatcgtcgtacgtgtcggtgctcatgaaggtcggtgaat
cgttgcgagcactcatgcacccactgtcgtggccgcacgtgtatcttcctgtacttccccgacgaatgctacagtaccttgagtgcccgacgccgttcat
ttttggtgcggagaagcaagcacttgacgatgcccagcgccaactcatcgaagaaggcggggacgatctcttcgcaggggctggagaggagctgttggtt
gtggatttggacaagggagctgttttacgtggagaagttccgtgctcacttcctgacagtgtgcgatttgatttacgagacgcactttatgagtgcttga
aaccaaacgtaagccgtagtgatcacgtatttgcccaccacttcccgagcaaaccgctcgttttcccagaggttgcagtccgcgggcttttcctccgcgc
tgtgaacaaacttatcggagactttggctaccatcgctacgtctggacggacgagtttgcacgcaaacgcaccgtcttcttcgacgaggccagctatctt
gctgcttccacacccgaaatgcgcgagttccgaacgcagttcattgctactcaagctttctcggagtttatggtaactcatcatggctttgaagagcatc
cgggccagtcgaccagcacggtagggcttccaagatcttcttcgtcggcttctactgcgtcctcctcctctgtctcctccttgccacggaaataagtccg
gtatgctaaacgtatgtgtcgatatgaattgtagtgctttgtgaggtatcgttgctgagctaaaccaacttgatatttactgtcgatctctgtttatctc
gtgttcaacgatgaaacatggaggccaggaacgtggtagcagccaataatccaagaactgctgttggtgctgtgaatcgcgacgtccacgaccacttcga
ctccattgcagctattggggttacgctgggaacttgtatttgatgctgacggtgtcttgccatttccttgtcgatgatagtgtagagaatggctgccaca
cgacgaccgctatgcttcagcatcggtgctttcttccactctttctccacgtgaccagctaccagatcttcttgaaaagtttggccttgaagcagcacag
gatgttgactagctgccatttcaggtgtagggagtaaaagttcttcaccgcgttctacgtacggagccagcacgtcttccggtggatatgtgttgttagc
gatcacatagtcgatagcattggctccaagataagtggagagcacgtccaatgtcttctccagcgtgtagccgtccgtctgaccattctgcgtcgtcacg
ttgctcacatacacggttgcacctgcgctgcgtgcgatggcgtcgcggatcccaggaaccaaaagtgtggcgataatggacgtgtagaagccaccagggc
tcaggataatgatgtcggcttcttcgatggcgcgtacagctggatggaaggcttccacgttcgagttctcgaggtacactcgcttaattggagccttctt
gatcttctccttgtcaggctttggtggcgatgctggtggtgttccacttgtgctacttgtcgacgactcggaaccggaatgaggttgttcgctttcgtct
gggataaaaggactgcggacattgacttccgaaacgactgtagaaccgtcagtcaactcggcgcacaactcagtactttcgagagtggcaggcagcacgg
agccgtggatattgaggatatctgcaattgacgagacagcacggtcaaagccaccttgaaggtccgtcagcgctgccagcaacagattccccaagctgca
tccttccatgaagttttcccggaaacgatagttcatcagcttactcagtagttcgtctacaaaatgaacagaaactcttatgagcacgaagatggatttt
caacaaaaaaacaaattacgaaccggagtcggacagggccacaagacaattgcggatgtctccaggtggaaggatgcccagatatttgcgaagagcacca
gaatgccggcccgaatcgaatactgtgcaagaattggtaaggcaaaatggaaaaaagaaacctcatagcttgtacctgtgacgacagcagtgagatcagc
cggatagtgtcgtagttccttgagtagtacagccaagcctgtgcctcccccaattgccacgatcttgggctgcagcatctcctggtctgccagctttaca
attggcagcaattgctcaatcgactcaatctaacacacaagaaacgttagccatggaagactttaaaggataaatagtcttcgtacctggaagtttggct
gctccatctcgtccgtaggcatcacgctcgtatacttgccgaacaactgcagtacaaactcagtcaaagcatacagagatacccttgtattcatctccac
gtaccattcggacagtgagcattcccactgtattggccgctttgatctcgtagaaagctttgcgacccacgaacatcacagcagacgacggcacttccag
ttgtcttgagagctgcttcatagcgctcgtgacctgcgctaagctcgggttgggactcacgtggaccacctggtcgaacaagtcgtcgactccaagagct
ttgagccgttcacgctgcacttctggcttgccaatgagaagcagcgctaaacgacaagcaccgccgtcttgtagctccaatagcgtcttacgtacacccg
ggaagggcgtaatacgccttgcttcggggacattactctcataataagctgcaatgacccgttgcgcttgtaccggtgataacttggcttgtggcccacc
cacgagactgtcgacaaagcgggggaaccgcttacggagtccgtaggcgttgcggaaggtctgcagcgcttcaaatgctgcagcgttcgtaggaaatgcc
ccttctgtcagcaattgagccacacctcggtcgattgccaagtgtgacaacaggcctgagtggtcgtacaatacgtcatctaggatcatagccacggcac
gcacgcggcgacgaggtggacgggaggaggtcggagagccatcggatgtaggcacgcgcatcccgcttggaaggcggtgcagcgggtgcttggaaggagg
aggaatggcgtccgacatggaagcggcacttagggacggaacgaggagtgacgttccaagcagcaaaaagaaggtaccaccatgaaatgacaaagagtcg
acaagttacagaccggtagtgtgtatctatgggtgtgtatggtcaagcgggttagttcgagtagtatctaccgacgctgcagcatacgcaacgccatctc
ttcttggctagcgacagcctggcgatcgatcttctgcttgccgtcgttgtcgtcatcgtcgctgtcgtcttcgctagagtcctcactgctaccggatccg
ctcatgtcctcgtcatcggagcccacaacaaggcgcgcgccttcatcgtcactctcgtcgtcgcgttcgcccttgaccttcatgcgcttcttgtggtgct
tggcacgcacacgctccttctccaaacgacgatcctcgtcgtccttggcggcgagacgagcggccacctgctctgtgtagtcctgagcatgtttctccac
gtccgcgaactcggcgtcaccagtgctgcgcgccgaaagacggtccgcaatcttcgcactgttgccttcctcgtcgaacacgatcttggaagcgttgatg
gcctcacggtccacacgcagcttcttctgcttctttttactcggcccaagcgcatccaagtcaagttcctcttcgtcttcatcccagttgtgtactcgct
tgaccaccatgagcgaatcttcatcgtcttcctcttcagactcctcctctttctcctgcttctgtgccaacttcttcttggcttcttcctgctccttggg
acccaaagcagccagctgtcgcgccaaacgcttgcgctccttctccgctttaatcttctccttaagctgctggagctttcggttgacgttcttctttccg
cggagctcctcacgtagagcttcgttgcctcccttttcatgttctgccttcatcttggacaggaacggcatgcgtggtgcaccaggaagtcccatcgact
cggcgaactcgtccagagggagagcagtggcattgaacacctcatgatcaggctgcaggtagaccgagcgcacgtacgacataaacgccttctgtgccaa
tgctttgatctctttgtcaccggctacgacagacgccaccttttgacggcagctcgtggttttagcagggttcaacttcgtctcacggataggcaccttg
gcatcctcaagacgcttcagcatgccgtccacctcagacggcacgaggcacattagagccttaccctgcttgttgtaacgcgctgtacgaccgacacggt
gaatgtagttagcggaatcttccgggcagtccagttgcagcacccagtccacttgagggaaatccagaccacgcgcagcaatatccgtagcaaacagcac
agcagcgggcttgttcaggaactcgtagtacacctccacgcgcttcccctgcttgtatttaccatgcagcgcacaaagtgggatacccggttgcagttta
cagaacacactgtgcacgaagcgaacctggcggcatgtggacaggaagacgatcgtcttctgcttcaggtgcgacttgatgaacgacagcagcacatcca
gtttacgttccagaggcgtgacgacataactctgtgaaaggcccttaggcgtcgcgttggctgagtgttcgtgtacggcaacgtactccggttcccttag
actgagagctgccagatccttcaccgacttcgtttgcgtggctgagaacagcatcgtttgtcgttctccagcaggcggcaagtgctccaagatggcagtc
aattgtttctggaaacctaaatccagaatccgatcagcttcgtccagcaccagcacttgtaggttgctagcatcgaacgccggtgtctgttccatgtgct
gcagtagtctaccaggtgtacagatcagtagattcatccgaatgagacgcatttgctcctctttgaagttttttcctccaattaccaggccagccgagaa
tgcgtgggccttgccgacattgcgcagcacttcgaaaatctgcagcgccagctctcgcgtcggtgaaataaccagagctcccagtccgtcctccacgctc
caacgcatacggaagagcttctccaaca