Description :
From Genome Similarity Track
Location :
Scaffold_1127:1656- 3928
Sequence
2272 bases(100 bases per row)
TTACCTCCCGGTAGAGTTGTACGTCATGAAATTGACCTAGTTCCAGTAGCTAAATACTGCGTAACATGGCAATGGCCTTTACCTAAGGAACAGTGTGACG
TCATTGACGATTTCTTTCGTGCTAAGCATGCGGCGGGAATGGTGCGGGAGAGTGAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGG
TAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATCTCTAGAAAGGATGTTTTTCAGAACAATATGGTG
GGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAACACCCCGAGCG
GTATGCTATAGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCACGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTA
TGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACAGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAG
TGCATGCGAATAAATTGTATGAAAATGCATCTAGATGCATCTTTGCTTCAGAAGAGATTTCCTTTCTGGGATGCTTCATTGGGAAGCGAGGCCTTCGAGC
GGACACCGCTAAGGTAAGGTCCATAGTCGATTGGCCGGTTCTAAAGAACCAAAAAGATCTACAGAAGTGACTTGGCCTTGCCTATACTTGCATAAGTATA
GTGCGAAATACGCAGATATAGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAGCACCGAACATGATGCTTTTCAAGCAGT
TAAGGAAAGTCTCCTTCACGCGCCAATACTGGCTTTGCCCAATTCTGATCGTCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCT
CTATTACAAACAGATGTCGATGGATGCGAACGCGTCATTGCATTCGAATATCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTGATGACAAAGAGA
TACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGGTCCAAGCTATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGAC
ACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTCTTATTGTTTGCCGAATATAACTTCGAAGTGAAGTACAAGTCAGGAAAGCAAAATTCTTTG
GCTGATGCGCTATCGCGCCGATCTGACTATGATCTTGCTCACGTCACTACGCTGTCATCTGCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATG
AACAATGTGTAGCTGTGCTACGTGCTCTTGGAAGCGAGGCGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGACTACATCGATATTC
TATCGATAATGGCCTGTTGTGCTATCGCACGGATATTGAGGATAACCCTCGTTCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGG
CACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGTTGGCCCAAACTATACAAGTGGGTGAGCAA
CTATGTGCGTACATATAAAGCGTGTTAACGAGTTAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGCCTTTACCCACTGGGTGTTGGGAGTCC
ATAAGTATGGACTTTGTGTTCGGCCTACCGAAAGATTCGGAGGCAACACTGGCATTGTGGTCTTTGTTGACCGACTGAGCAAGATGGCTCATCTAGCGGC
AGTGCCGGACTCTATTGATCCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAGCATGGTTTGCCAGTGACCATTGTCTGTGATAGAGAT
CCCCGCTTCACTGGAAAGTTTTGGAAGTCCATCTTCAAGGTTCTCGGCACCCGTCTGGATATGTCCGCAGCGGGTCATCCGCAGATCGATGGTCAAACTG
AGCGTGTTAATCGCGTCATTAATGACATTGTGCGCAGTGTTTGCGCTGATACGCCCAAGCGTTGGATCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAA
CAACGCTGTTCATGCCTTTACAGGCTATATACTCCTTTCTACGTAAACGGTCTCACCCACCCTCTCGTTCTG