Description :
From Genome Similarity Track
Location :
Scaffold_45:1656- 3868
Transcript NameFunction/comments
Phypl_g1689hypothetical protein

Sequence
2212 bases(100 bases per row)
AGCTCGCGTCTTGTTTTCTTACGCACCCCGACTTTCCCTGAGCGGCGCAACACAACACGTTTACCGAGCGATTCAGGAATGGATTCGCCACATTCGAAAT
CTTCATGCCAGATCTGAAAGCGCGTTTTTGCCTAACCCTGGTACTCACGTCTTGCTTTCGGACAGAGGGAGCACTTCGCGGCACCATTGGAGCAGGCTTA
GCAGTAAAATCTTGTCTGGAATGACTTCTTTCGCTTGCCACGGAGAAGAGCGCACACTTGGTAAGAGCGCTGTCAACGCTTTTGGACGCCTGATACAGTA
ACCCAGTCATCGAACCGCTTGTGTGTATGCGCCGACTGCCGGCGACGCTTGGTACGAGAGCGACCGCCCGGCAACGGAGTCGATATATCATCTATGTGAA
AATCTTCAGGGTTGAGCTGCCGAAGTTGTTTGTGGAGAACATTCATCAACTCCCCCCTCAACATTGGAGCAATCCTTTTGATCCGGCTGACTTCCTTGTG
AGTGATGAACGCGTTTACAAAGCAATGTCAACAAATCCCACCAATAAAGACTTGTAGTATTTCCGGAATCGGGAGGCAGTCTGGATAGAATAGGACTGGA
GGCGGGGTTGGTCGTGCACATCAACTCCACCCATCCAACTCTGGTAGTCGGTCACAATCTTTGGACATTGAACGGTTGTTGAACCAACTTGCCTAACGTT
GCGCTGGATTTGATCTTCGATCATTGATACACCAGTAACCAGATAGTGAACTGGCTTGTGGTCCCACCAATGACACGCAACCATGGTGGGAGCCGGAACA
CATCGGGAGAACGTAAAAGTTCCTCGCTCAATTGACCGAGGAcggcgcttgcgcttctcaATCACTTGAACATCGAAGCCGATTCGATTTGTCGCGATAG
TGCCGATAACGTAGATCGACATCGAGAAGAGCTGAAGGGCTAATGCGAGCGACGAGTAGAATCGGTCGATAACGACTAAATGATAGCCACGCGAGATTTC
TCTAAGAACAATCCTCATATTGCGAATGACGGCAGCCGCACCCGTCTTGTTATCAACAGCCTGGCCCACCGAATCATCCATCTGGCGTGCTCCAACGTAG
ACTTCAAAGCTTTAAGTTACAACAGTAGCGAGCTAGTCATACAACCAAATCTGTAAGTTACGCTTAGATCAAACAAAAAATCACGTACCGGTGGCAGTAC
GCAGTCTTCGAATCCCACATCATAAGCATTTTTGTGCCGTAGCGATGAGGCTTGTCAGGCATGAACATGCGTGTACCGTTCCTTCGCGATGTGGACGACA
GCGCGCCTTCATCAGAAGAAAACATTGCGGGTAGCGTCCATGCCGAGAGACATCGCTCCTATAGAACGTCCACGACTCGCCTTAGTTTCCACATGTTGTC
TCGCACACGAGGTGCCTCGTTATTTACAAAATGCAAGTCGCGGAGAATATAATTGCACCGGTTGCGAGCCATGTACCGCCCAAAGGTACCAGCATGTATT
GCTCCCTCGTCTGTCATTGACCAGTGACTCGAAAATCTCCGTTTGTGCTGACACAGCACATGAGCAACGAGGAGTCAAAGGATGTGCAAGATCTCACACG
TGTCGTAGGACTTCTCACTCCGCAAACGACGACGAATTTGGTGCTGCGTTTCAGGTGCTGATGACCGGTGCAAGCGCATCTGGTTTGCCCGCTTTCACGC
GGCACGGGGATCAATCGTTTGCTTCCTGTACCGATTGGTTTCCTCCGTAATTCGAATCCACAACGACTTAGGCAAGAAACAAAACAACAGCGTGAGCGGA
GAGTCCCCTGCGTACGTAGCTCACAAATAGGTGTAGCAACATCCGGCAAAAACCGAGAGTAGCTGGCCGGGTTCGCCTCGAACGTTGAAGCGATGGAGTG
CTCCGCGCGGTAGCAGGCAGTGCTTCCTTGTCGATATCATTGATAGCCAGTGAACCCCCGAGCGATTCAATAAATGCCTCATCCGCCATTGCCACTTCAC
TGTCGGATAAAGCGTCCTCGTCAGGATACTCGCGACGCTCCACATCCTCCTCGTCTGGGtcatcttcgccttcactCGCGCTACACTCCACAATTTCGTA
GGCGTCAgtgtcctcgtcgtccttcacGATATTGACATCATCTACGCGGAGCTGGGATGCAGATTCACTCGTGAATTGCAGATGATCGTTCTCCTCACAC
TTTCCTTCATCC