Description :
From Genome Similarity Track
Location :
Scaffold_720:1656- 2927
Sequence
1271 bases(100 bases per row)
GAGGGAAAAGAAGGGGAGAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGATATGAACTCCGCTATGCTCCGGTCGGAGCAACAGCGAGCTGGGGTGG
CTATCTCAAAACTGGGTGGTAGAGCCAGATAATGGGTTCTCACTTGTAGCACGTCAATAGACGAAGCTTTCCCCACATGGGATTTGCTAAAACAACATAT
ATCCCGGGTGTTTACTCCGCCTAATCAGGCATACCGGGTGCGTTCTCTTTTCCTATCTGACCGTTAGGGCAAGAAAGAACTATTGGACTATGTCCAGGAA
CTGAGAACTCTAATCGCTGCCATACTGCTTGATCCCTTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGAACGGGCGTGGATCGAACGG
AAGTATTCCGGGTACACCCTACCTCCTTTGAAGCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTACGGCAGCCCGTTTTGGCACCCATGGGAA
CAACCCAAACTCGACGAACTCCTTTAGTTCATTCAATAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCTAGCTGTA
GAACAGCATCGAAACATTCGACGATGTTTCAAGTGCGAAAGAACAAAGCATCTACGACCAAATTGTCCTTTACGCAGGGCACGCCAGACTACTTCAGGCC
GAACTCCCGCCTCTTACCAGAAGTCTAGTACGGTGCGGGAAAACATAGATTCCCAGTAGGCACGGGCCACCCTGCTGGGGAAAACTAGGTTCTGTTGAGC
CTCTAGGAGGTAGTGGCGAGCAGAATTTAGCCCCAAGGAGTCCCGTGTACTCTAACACGAAACGTGACTACGAGCCAGGCTTGTTGGTGACTGTTAAGGG
CTTTGATCGACTCCGGAGCATCCGGTAATTACGTCAGACGCTGTTCCCCAGAAGGGAATCCAGGTTATGTTGAGGCACTAAAAGCGCACAAGGGGGATAA
TATCACTGTTCGCTTGGCGACAGGGACTCTAGTCACTGCAACGAAAGTTCTTGTGAACTTGGGTGTGAAGTTTTTCGATTTTGATAGTATCAAACGCTCC
TTGATTTGGACTCGAGATATCTCATTTTTTATGGCTTGGTTCGAGCGCCATGAGACATGGATTGACTGGAGGTCGAAAACATTAGGCGCCACGCGCACTA
CCTCAAGCGGAGCTTTGGAGAGTCACGAACCCACCTCTGCTAGGAATCAGAACCGTTGTTGGCGCGAGCCA