Description :
From Genome Similarity Track
Location :
Scaffold_4:1655931- 1660982
Transcript NameFunction/comments
Phyin_T30-4PITG_03416Cysteine protease family C01A%2C putative
Phyin_T30-4PITG_03417Mitochondrial Carrier (MC) Family
Phyin_T30-4PITG_03418Putative uncharacterized protein

Sequence
5051 bases(100 bases per row)
CCTAGTGCGCCGCCATCTCAGCGTTCGCTGCGGGGCGGGTAGCATACATAGCAGAGTTCTGCTTACGCATCGCCTTGAGTCTCCGCTGCGAGAAGAGCAT
GCCAATGGCTGTCATCACAATCGTGAAAATAGTCGTCACTGCCGCCACAACTATCCAGGTCGACGGACTGAGACCGACAAAAACCTTGTCACCACCACTA
TCTACGCTGGTGGATGCTGCAGCCCCAGCCGAAGCACCTGTGGGGATGACGGGAAAGATGTTCAGACCGCAGTTGACTTTGGAGTCTGCCACGAGCTTCA
TGAAGCCACTGGCTCCCCAGGAGCTGCCGTACGAGTTTTTAAGAATCCAGTAGTCTCCAACCGAAGCGTCAGTGCCGTAGCCTACAAGTACAAGAGCGTG
GTTTACGTCGTCCTTCGAGGACAGATCGCCATCGTTCGGGCAACTGTAGAAGCCACCAGCATATTCTCCGAATGGGTCCTCCGAGTTAATCGCTACAGCA
ATCGGTTGCTTCTCCAACGCAGTGCGGAGCAAGGTGCCGCAATTGTTCGAAGCCGTGCAGTCTGTGCCCACAACCTGTTCCCAGCCTGTAATGCTGGCAG
CCGTCTTGTTATCACTCACCGAACATGCTGATGACACATTGCTTGAGGACGTACTACTTGAGCTGGAGTCGTCGTATGGCATCGTAAGCTCCGTAACAAG
GCTCCAGCCATTCTGTGCCGCGTCGATGAAGGCACCGTGGGTCATACCACCATTGCACCCGTTATTCTGCGATTCCCACTTGATCTCAGTTTCCATCCAG
CTAGCACCGTCCACACCGCTGTCTGATGCCCAGCAATACTCGAATGTCTGCGTCGTCTCCAGTGTACTGCACGTCAGAAATTGCTGCGGAGAGAGCGACA
CAGCCGCCGACGCGTTTTCAGCAATGACGACAGCCGTCTCAATGGCGTCGGCGGCAGCGAATGCCCAGCAGCTCCCGCAGTTTTGCTGGCTCTTGACGGA
CGAGCACACACTGTAGCCGAACGAGTTGTCCGAGTCACACCAGTTCCAGTACTCGGAGCTACCGGAGCTCGACACTGTGCTTGTGGCGGAAGCCGTGCTG
CCGCTGGCCTCCACCTTAAGGCGACGTGAATATGCCGACTTGACCTCTTGATCCACGAGCTGCTGAGGAGAGAGACGGCGTCTGGCTGACGAAGTCAAGT
GGCGCTCGTTCACGCCCATGTGGTACGAAAAATCGTGGCCCACGCTGTTAGCGTACATGTGTACATCCTCTATATACGTCATGTGTGCCTGTAGGTTGCG
GGTGAGGCTCTCGCGCTCGCTGAAGGAGACGAGGTTGCGCCGAATGAGCAGATCGCGCAAGGTCTTCGAGTCGACGACCTCTCCATTCTCGCCCGCCCAG
AGGCATTGAGAGTCGGCCGAGCGAAACGCGGGGCAGTCCACTAGAGTACCAAGAGAGTGCTCTGTGGTGCTAGCGGTCAAGGAAGAGACGACGCCCATGA
AGAGCGCAGTGAGGGACGCTTGCACGCGCATATTATCCGTCGTAGATGAGATTTAAAGGAATGCTGTCTCTTTGTGAGCTGGACGCTTGAAAAAAAGCGT
TTTTCGTTTTCTTTTTGTGACATCATGTCACTGACATGAGTTTACTGTTGACTCAGTTCTACAGTAGACCAAGTCACACGGTGAGCACAAAATCCATGCC
GTTGGACAAGCTACGGCCTTTGCTGCATGCGGTGTTTCAAACAGTGTAAGTACATGCACAGGCAAGGAACTTCCAAGTGGTTTTACTTATACAACGAAGA
TGCCATTAAGTCTTCGCTGAGAATCAGTGAGATGGTCGCAGAGGTGGATGAGATGCTTGCGGAATAACATAACAGGCACGTATCCTTGGCTAATTTGGCT
CCAGAATCGCCTGAGGATTGCACCTCCACGAAATACTTCGCTCGTCATGAGCACGAAAGCAAACCATGTTGGCGCTGCGCTGGTCTCATTTGTGGGTTCG
CAAGGATAGTTTCCTCTGCTGTGCTTGGTCCACTCTAGTACAATAGTAGATCCATATTGGCAATCGCGCGTGAGCCAAGCAGACTAACCAAGCAGAACGA
ATGTCGTTATGATACCGTGTGTTGCCAATGACATGTGAGCGACGCTCGCTGAGCGCGCATAATTCGCGAGGCCGTTTTGTTAGTGCAGCGTCGACGACGA
GCGTTGCATCTTGCGACGCTCTCGTCCTGGGTGATTGATTTTCTGTTTAATAAGTTCATGTACTGTGGCCGCGATATGAGGTTCCAGCAGTAGCTGCAAA
AGCTGGGGCAACAAAGCCAAGCCCATTTCGCTGCACTTCTGTCGGTGGTGACCGCTAAACCAGGCATTTAGAGCCAATACTTCATCTGCCGAATCGGCGT
GTGGCAAAGACGGTCAAGGAAAGCAGACCTGATGTGCAGACCCTGACATCTACGTCATTCTCCAATTCGCTGCCTTCTCGCGCGCACGAGTCGCACAACA
ATCTAGCTAGCGCAACTATAATAAACGGCACCACCCTCCCAATCGAAAACGATGGCGACCCAAGCAGGCGTGAAGGAAGAGGCCCCGCTCCAGGTGAAGA
AAGGGATCGAGCCACAGTGGACGCGCTTCCTCGCCGGTGGCGCCGCGTCGGCCACCGCCGAGCTGCTCACTCTGCCCATTGACATCACCAAGGTGCGATT
GCAGGCGCAGCGCTCTGGTCCCACGGCTGGCGGAAAACCGACGGTACACTACAATGGCATGGTGCACGCAGCTCAAACCATGATCAAGCAGGAGGGCCCT
GGCGCGCTCTGGAATGGCGCCACCCCCGCGCTGTTACGTCAAGTCTCGTACACGAGCATCTGCATGGTGCTCTATGAACCGCTGCGTAACTTCTTCGGTG
CGAATGCGGCTCAAGGTGCGAACGGTGAAGCTCCCTTCATCAATAAGTTCTTGGCCGGCGGTTGTGCCGGTGCCATCGGCATCAGCATCGCCAACCCGTA
CGTTTACAATGCTCTTCTTGGGTATATTGGCGCTTGATTTAATTGAATGGTGTTGTAGTGTGGATGTCATCAAGGTACGGATGCAGGCAGACCGCTCGGG
CAAGCTGTACCGTGGCGTCGGCGACGCATTTAGCATGATCTACCAGCGAGAAGGTTTCCGCGGTTTCTTACGTGGTATGCCACCGAACATTCAGCGCGGC
TTCATCGTGAACGCTGCTGAACTGGGAACGTACGACCACAGCAAGGAGCTGCTGATCTCATCTGGGCTGCTCAAGGAAGGCGTACTCGCGCATACTGGCG
CAAGTTGCGTCGCTGGATTCGCCGGTGCTGCAGCTTCCAACCCGTAAGTTTTTTTGCTTTTGCAGGTCGAAGCTGTTGGGATCAGCATAATGACGTCCTT
GTTGCGACGATTGCCTTGGACAGGATCGACGTGGTCAAGACTCGTCTCATGAGCCAACCGACGGATGCAAGTGGCAAGGGGCTTCACTACAAGGGCATGA
TGGACTGCGTTCGAAAGACCTTCCAGGAAGGTGGTGCGAGTGCCTTCTACAAGGGTTTTATCCCCAACTGGATGCGAAAGGCACCCTGGTGCGTTGTCTT
CTTCGTCACGTACGAGAAGTACCGCGCCGCAATGATTCCGAGTGAAGAGGAGATGTAAATGCGTTCGACCCAGCAAGTGCTGCTAGGTCGTGGATAACAA
GCCTAGATTTCCAACAAGAATCAATCTTACAACAAAAACCCTGATTTAATCATCACGCTTTTTGATGTTCAAGCTCACTACACTGTGTGCTACCAGCTCA
TGCAGAGTCCATCGCTGCTACCGACCTTTGCTGCCTGATAAATAAGAATACACTTTCCTTTCCAATGAAGGCACAAGCGCGTCTCCCGTTGGGCCAAAAC
AGGGGATGGCGTCGAGAAAGCTTCTCTTTCGCTTCCATTTGCATGAGTCTTGACGCTGTAAAATCTGACTTCGTTCGGCCACCAATGAGGTGGTCTTCAT
TCAAAATCCATCTGGGCCTCCTTCTTACGAAGGCATCCACGCTTTTTTGTTCAACATTTAAGCTCCTCAAAGTCGTGCATCTGCATGTACCACGTTGAGC
GCGGCGGCGTCAGGTAGTGCAGGGTTGAAGCCCCGGGGGCCATATTTTCGACTAGCTTCTCGCGCAGATCAATAAACTCATCCGTCTGAACGACATTGAT
CTTCTCATTGTCCGTAGGAATCGAGATCTTTCTACTCTTTGGCAGCATGACGATGGGAAGGCGCTCGAGAACACGGTCCTCTGTCGACCACCGATCGCGA
GAGATCACGTGCACGTTGAGGGTGGAAAAGGATCCGTTCATGAACCTGTTGGAAATAGTGCTCTCCACAGAGGGCACAGACGTCTCCTCCTCCTCTTCCT
CCTCGGAGCAGTAGTAGGCCGGACATGTGCGGCGGCGACGCGTGTGGTGAGTATTCGTATTGATATTCTTGGCAAAGAGCGAGCGACGAAACCGGTCGCG
CTCCTGTCGTCGCGTCTCTAGCATCTCCTCACGCGACAAACGCGGCTGATTGCTGTTTCCGGTATCACTGGGGGCAACCTGGGCGCTGTTGCTACTTCCT
CCAAGAAAGCTGCCGTTGTTGCTGCTGATGCTCCCACGGCTGGTGCGATTCAGGGCCCTAAGCAGCTTCTGCAGCGCCACGAAAGTCTCGTCCACTTCCT
CGTCCTCGGCGGAGAGACTAGGGTCGTCCTCCTCAGACACACTGCCCGTGTACGAAGGCATCTTCTTGGACAATCGGGTCTCGGACTTCGCCATCTTGTC
TCAATTCTGATCACTCTTTTCTTTGTGTGGAATTTTTGCTTATAACCGCAGCAAATGAGATCTCCGGGTCATGTAGCAGATTGTAATGTGTAAGGCAGCT
CCGGTGCGTGCGCTCCCGTGTCTACGCGAAACGCTTGCGAGTGGCTTTCTCAGCGGCTGCCTTCTTGGTGGACAACGAAAGCGATTCTGGGACGCAGACT
GCTCGACTTTTAGCGCTTCATAAACGCGGTGGAGCGATCGGTTTTCACAGG