Description :
From Genome Similarity Track
Location :
contig_55:165582- 167064
Transcript NameFunction/comments
g9273.t1hypothetical protein
g9274.t1hypothetical protein

Sequence
1482 bases(100 bases per row)
CTGCAGACAAGCAGCAAGACTTTAAGGGGTTCCGCAGCGAGCTTGGCGATATCCTTCGTGACTGCTGCCAGCTGCTGGTGTTGAGGCTGTTTTGCAGCAC
TGTGTGAATGGCTTGAACCAGATTTTCCAAGCACCAACGGAGTCACGAAAGTTGGGAGGCCGTGGAGGCCCATTTGTATTGCTTCCGGTCCATTGCGCGG
GAAGTTGAAAAATCGACAGCCAATATGGAGGCTCTGGATGCACCAATTTCGCTTATCTTTCAACACCTTCCGCGGTTCGCTGACCACCCTGCAATCTGCT
ACACATCGTGCCTCATTGTGTCGCGCTACGCTGAATGGTTACGCGCGCATCCACATCGCTTCAAGCCCAGGTGGGATTTCTGAACACCTGCGTGACAACT
AGTGCGGGGGACGCAAGATACAAAGAGTGGGAAGTGGCGCGAGCCGCTGCTGCAGCGAGCGATTCGGGCACTGGCTATGGACTGCTGGTCGATGCTCGGA
GGGGATATTGTTGCCTTTTACTTACACATCGAGGAGCGTGAGCTCATGGTAGTTGATGACCAAGTGCTGATTCTTGAAGGCATCTGCGCTGGCGTGGCCA
AATCAGGCGACATGCCTCGCATTTTGGCCGTGCTGGATCAGGTTATGAAGGGCATTGGTCAGCGACTGACTGCGCTGTTCACTTTGGCTGCCGCTAAAAG
CCATGTGCAGGTTGCGCTCAACGAGCTTCTGCGACTCATGTGCATTTATGAGTACTTGGGACATCAAGAAGCTGCAAGGAGAGAAGCACCCGCTTGTAAT
GCTCACGGAGCAATTGTGGCCGCTGTTTAACCAGATGCTAGCGTTGTATCGCGGTCACGATGAGCTCGTGGAACGTGTGTGTCGTTGCTATAAGCGCATT
CTTTCGCACGTGTGGTGCAGAGATTGTTCCTCTGTTACCGCAGCTTGTAGACAACTTGCTGGCGTTCTATCAAGCGGAGCCCAAGTCGTCGTATCTCTAT
ACCGCCAGCATGGTGCTTAAGTTCTTTGCTCATGACCAGAGCAAGTCGGCGGAGCTGGACCCCTTGTTCGCTCGTTTGCTTTTCAACGCTGGTGGAGACG
ACAATTCCTATCTTCGCGAGTGTCGACGACATGCAGACCCGTCCTGATGTGGTGGAGGAGTTCTTTTTTCTCATGGAACGCGCCGTGCGGTGTGTGCCGC
AAGTACTTGCCGCTCCTGTAGCACCAGGGCAAGCTCGGCCGCTTATGACGAGTGTTTTCTCGTGCGCAGTGTCAGCTCTGGCGATGTCACACAATGATGC
CAATAAAGCTGTGTTGTGCTTTATGGAGCAAGTGTACGTGCAATCCTTGACGGAGGGTTCGCACGTTAAACTTGTATCGCTGTGTGCATCCAACAACGCT
ACGCACGAGGAGAGCAACAAAATGTTGGTAAGTTATCTGCTACGGGGTGTCGTTCTTGGGCAATGTCACCATCACGCGTGGA