Description :
From Genome Similarity Track
Location :
scaffold_2:165578- 172956
Transcript NameFunction/comments
g1040.t1 hypothetical protein PHYSODRAFT_245970
g1041.t1 hypothetical protein PHYSODRAFT_488328
g1042.t1 hypothetical protein PHYSODRAFT_328487
g1043.t1 hypothetical protein PHYSODRAFT_488328
g1044.t1 hypothetical protein PHYSODRAFT_359897

Sequence
7378 bases(100 bases per row)
AATCTGACAGGGAAGTGGATGTCCGCGTGACGTACTGCGTCGTCTCCATCGCTAACTTGTACGGTATCCTGACGGATGAACTGAAGGCTGGCGTGGTGGA
CTACGTGCTGTCCTGTCAGACGTACGAGGGCGGCTTTGGTGGCGAGCCGGACAACGAAGCCCATGGCGGCTACGCTTTCTGCTCCGTGGCGGCACTCTAC
ATTCTCGAGGCTGTGGGTCAGATTCGGGACCTTCCTGGACTTCTGCATTGGCTTGCGAATCGCCAGATGCCGTTTGAAGGTGGCTACCAGGGACGCACGA
ACAAGCTTGTGGACGGCTGCTACAGTTTCTGGCAGGGTGCAGTGCCAGCATTGCTGGCTGACGTTGTGCGAGAACGGTACGGTGATGACGTGCCGTATCA
ATGCCATCAAGAGCAGTTGCAGAAGTACATTCTGCTCTGCGGACAGGAGATTTCTGGCGGACTACGAGACAAGCCCGGCAAGCCGCGTGACCATTACCAC
TCGTGCTATTGCTTGAGTGGTTTGTCGGTGGCACAACACGGAGATGGCAAAGGCGAGCCGGTCGTTTTTGGAGATGCATCCAACCTGGTGGCGCGCACGC
ACCCAGCGTACAACATTGGCTACGACAAGGCTATGAAGGCAATCGCATATTTCAAGGCGAAGGGCCCCTTCGAACCGGAGTAGAGCAGGTAAAGTACCAT
GCCATAGATCCTGCGCAGAATGGTGCCAAATGGAAGTTTACCTGGTCGATGATCTTAACAAGCATTGCACTAGGCATTCACTTTGTGTTTTTGCGTTGTC
ATTTGTTATAAGGGTGGAAGTTTCTCGGCTGTGTCGTCGCCATTAGCATCACTACTAGTATCGTGGTCTTTATGGTTTATGCTACGCAGGGACGATGAGG
CTGCCAGCTTGGGCAAAGGAGGCTGAAAGTTCGAGGTCGATGAGTGTGAGCCGTGGTGAACAGGATGGTGCGAGTGGGGAGATGGATTTACCACAGTTAG
CGATGCTTTCCGCTTTTCTCGATCCCGGACTGACAAAATCGTAGATGGCGATGAAGCTGCTTCAGTCAGCAAGATTGCCTTCGAGATTGATGATCCACTC
CCCACATGCCGCTGCGCTCTCGCTTTGGCTCGATCTTTCCGCTTCTGCCGCTGCTGGAAAGGGGTCAAGTTCGCGCCCTGACTGCTTGCAGACCCACTTT
CCTCGTCGGAGCTCAAGTTTTGTGGAGAGTTGGAGTGAGTTCCCTGAATGAGGCCGCTGCCTTTCACTGAAAATGGCTGCTGCTTGGGTTTGGCTTGGAG
TAGCGTGGGCTTCAGCTTGCTATGCGCCAGCTTGCCTTTGGGGGATGGCTTCTTGTCGGCTTGTACATTTTCCGAGTTGCTATCTTGAGGAGAAGCACCC
AAGTAGTGGTCAAGTGACATTCCACTCACGTCGGACGTCGGTGCAAGCTTTTTCACCGTTGTAGGAAGCTGAGGTGGCAATGCCCGGAGAGATCCTGCTC
TGGGCAGCTTTTCCTGTGCAATGGCATCGACTTCATTCACGTGGAGATAGTCGCTCAGCGTCATACCCGCGAGCTCAGACGGTGGCTGTGCCTTTGGCGT
GGAAGTCTCGGACTCGTAGTCGTCTTCGTAGTCATCTTGCTCGCTCTTCCGCTCCGATGCTTTGGCACCTCCCGTCGCGAGTATCCGATCCGGGCCATCC
TTGTCTTCGCCTCCGACTTTTTCAGCTGCCATGACGTCGTTGTCGGTCGAGGTGTTGAGTAAATGCTGTGACACATGACCGCTCACTTTGTGTGCAGCGA
AGTAGTCTTCTAAGGTGGAACCTGCCAGTGCGTTCCCGTCGTCGCCGTCGCCATTGCAGCCTGTCTGTGTATTCAAATGTTGCTGCTGTCCCTTGCCCAT
GGTACTGCAACCTGGCCGCCATCACCCGATAAGCCTGAATCGAGGGGTGTAACGACCATGCCGAGCTGAGTCGTTTCAAGTCCACTTCAACTTGTTCTGG
GTTCGCTTTTAGGCGAGAATGTGATGCTTAGAGGTGGATGGCAGACTTCACAGCAGGGTAGAATGTTCAACGAGAGAAAGCAGTGACCATTGCGAAACTG
TTGTTGATAAGCTAGCAGGCTGTGTAATACATCAATCAACTCGCGCCGAGTCAAGCAATCTCTAGTCTTTCAAGCTTCGCTGATCCAAGGGTTAAGGACG
TCTGGCTGGTAGATTTCTACGCTGATGAATACCCTGGTGTAAATTCTTGCAATCACCACTGCAGTACCTTGAATCTATGCTGGGTTCTACCGTGTTCAGG
ATGGCGCTGCCACCGCCAAATACACTCAGGTTCGGCAGCTCACGCAGCAAGCTTGTTACCAAACCTGAAAGCTAGTAACCCTTCGTCCAGTCGACTTGGT
AACGCACGGGTTCGCCCTTGAGGTAGCGGTTGAAGTTGTCCAGGAACATGGCTGCCACGTCTTCGGGGAAGACTTTGCCCGACACGTGCGGCGTCAGCAG
CACCGAGGGGTGTTCCCAGAGCTCGCTGTCGTTCGGAAGCGGCTCCTTCTCAAACACATCAAGCACGGCACGCGACAGTGTGCCCTTGTTCAGCGCGTCA
ATCAGTGTTTTCTCCGAGATGACGTCTCCACGGCCAATATTGATGAACACAGGACTGCGCGCGCGGCATTTCTCCAGGTTATCCTCGTTCAATAGATACC
GTGTGGCATTTGTGCTCGGAAGAACGTTGAGCAGGTAGTCGCTCTTGGATAGCAGGTCGTCTAGACTCGTGGTGATGTGATCCGCGCACTCTGCAAGCTC
AGCAACGTCCTGTGCACTCACGTGGCGCTTGAACCCCAGCACTTTGTAGCCGCAGCTGCGCAGCATCTTGCCCGTGTACTGGCCAATGTCTCCGAGTCCG
AGGATGCCCACAGTGACGGACTGGGCAGGTCGAAAGCTGATCATCTCGACGCGTGCGTAGTCGCGTTTGCTTTGGAACTCCTTGGCCTCCAGCAGCTTCC
TCTCGATCATAGTGACGTAACCCAGCACGTACTGCGCCATGATCCGCGGCATCATGCCGCCGGCCCGCGTCAATGTGAACTTGGGCAGCTGCTCTGCGGT
CAGAGCATTGGGTCCCTTGGGCAGCAGGTTGAGGTACATCTCCACGCCGGCGTAGGTGGCTTGCACCCACTTGACGTTGCTCAGAATGTGCTGCTTATCC
TCCGGCAGGTTCTCCTTGGGGTCGAGGAAAACGGGGCCACCGCCGTGGGAGTCAATGAGCACGATCTCCGCTTTCTCCACGACGCTTTGCTGCTCGGGCG
TGAGGTCCCAAATAGGTCTACCCGGGTCCACCATGCTTGGTCCGTGCAGTGGGTCCTGCTTGTTGCCCACCAACTGCGGCAGCGGGATGTCCACGAGTTC
CAGTTTGCCAGCCCGGTAGAATTCACCTGCAGGAGTCTCGGAAGCAGCAAATTCCTTGCGGACATTGTCTCCAATGCCGGCAATAAACGTCATGATGGGC
ACCCGCATACACGAAGCAGTCGCGACGGAATCGCCATTGGAAGACGTCGTAAACGCAGTCATAGCAGCGAACTGGCGAGTCGTTCGAGGCACCTCGCAAG
ATCGAAAGTGAGCTCCTCAAAACGGCAACGTATTTTAGGAGTAGGGTTATCAGATGGATACCCCTTTTATCAGCAACGTCAAACCTTACAAATATCAAGT
AACAGACTATTGGTTGCGCAATGAGAGTGTATGCTTTCAAAACACCATGATATGATGAGCGGCTGGAATGCAATCTCCATTAGGATATCCCACCACGTGT
TGGTAATTATCTTGTGCTCATGCCTGCGGCCTCGAAGCTCCGTGTTCCCATCGTGTCGTTCCTCAATGGAATGGGAACTGCCATTCGCAGCGAGTTCGCA
GCGTCTTCCACCCCCGCCGGAGACCTCTTTCGTGCCGGAAAACTGCAACTCGTGGACGTGCCCGTGCCAAAGTTAATTGGCAACACCCAAGACCCCCTCA
GCGGCCACAAGATGGACGACACGGGAGCTCCTCAGTGGGATCTGACGTCTGAGCAGCAGCGCGTCATCGAGCAGGCCAAGATTGTCGTGATGGACCAACA
TTCCGGGGGGCCGCTCTTCCTCACGCCCGAGGAAAGTCTACCCAAGGACAAGAGAGACATCCTCCGGAACATCGAGTGGGTTCAGGGAACGTATGCAGGT
GTGGAGCAGTATTTGAACCGACTGCCGCACGGTAAGAACGCACTGCCGGTGGATCAACTGCCCAAGTTCACGTTGACTCGTGCAGGAGGATTTCTGCCGC
GGATCATGGGCCAGTACGTCTTCGGATACGTCACGATGCTGGAGCGGATGCTGCTAGAAGCGATCGACTTTCAGCGCAATCGCACGTACGAACGAGAGCG
CATGATCGGGTTCAGACCGGCGCAGACCGTCACGATTGGTATCCTCGGTCTCGGAGACATTGGCCAGGGAGTGGGCAAGATGCTGCGAGCGGCAGGGTAC
AAGGTGCTGGGCTTCAAGCGCCGTGTGAACTCCCAGCTCGACCTGGCGTTGGCGGCCTGTGCGGATCGCGTCACGCCGGATCTGGACGAAGTGCTGTCCC
AAAGTGACTATTTGGTGAACGTGCTGCCGAGTACGAGCTCGACGCGCTACTTGTTGAACGAAAAGAACTTGGAGCTTTGCCGAGAACGCAAGCCAGTTTT
CATCAACATTGGTCGGGGCGACGTCGTTGCTGAAAAGACAATCATTGACGCTCTTGACAACGGTGTGTGGTCTCGCGCTGTTCTGGATGTCTTTGAGGAG
GAGCCACTCCCGCGCGAAAGTGCGCTGTGGGCCCACCCTTCTGTGCTGCTCACTCCACACGTGTCTGGCTACGTGTTCGTGGAAGACGTTGCCAGTATGT
TTGTGGACAACTTTGATCGGTATTTGCGCGGAGAGCCCGTGCTGTACAAGGTGGACTGGACGGCAGGGTATTGAAGACTCGATCGTGCTGGCGCTGCTTT
GACGGAGTCAACTCAGCACAAGACGAGCTTGAGATGATGTCGTAGCTCTGCTGGAACGTCGTATTTAGATATATGCTCGAACTTTTCAAAGTGCTGTGAA
TCCGCGTGTGTTCAACTACCATTTGTTGGCTTCTTTTTTTCAACATTTTCCAATTGTGAAACCAAAGTGAGTCCCTGAGCTGGGATCTGCTTGCCATCAT
CGCAATCACCCAGTCGATAGCGCCGCCACCAGCTCGTTGTGAAGACGTTGGGTAGTTATTAAGAATGCTTGTAGCTCAGGTGTTTTGATATTGGTGCTTC
GTGCCACGATGCAAGCCGCTCCAACGATCTATAGGATACGAGAATTCAGATTTTTTTGGGGGTAAGACGCATTAAAAATGTAGTACTTACCTCGTAGAGC
ACGAAGTCTGAGATAATAATTAGTGCAAGGACGACATCGAAAAGCGTCCATTGTTATGTGTTTTTTTACATAGTGGTTAGATACGCCCAAGGATAAGTGT
CGTTCGCAAAGATTCTAACGAACTCCACTGAGTTGCAAGACAAGTGTGATTATGCTAATGCATTGTATTGCTATTACCAGTGATACAAATGTGTCGGAGC
CTGGAAAATTTCTTTTCATTCGTGTAGTACAACATCTTTATTGAGTTCGTGGAATACAAGGAATCGGAATACAAAGAATCCACACAAGAAGCTCAGTACC
CCTTCGTCCAGTCCACAACATATTCCAGAGGCTCGCCACGAAGGTAGTGATTGAAGTTATCCAGCAACACGGGCCCGACATTTTCCGGAAACACTTTGCC
TGAAACATGGGGCGTCAAATGTACTGACGGATGCGCCCACAGCCCGCTCACGCGCGGCAGTGGCTCCTGTTCAAACACATCCAACACGGCCCGAGATAAG
ACACCTGCATCCAGGGCATCCAGCAGCGTCTTCTCGGAAATCACGTCTCCACGGCCAATGTTGATGAACACGGGACTTCGTTCACGACATTGCTGCAGAT
TCTTTTCGTTCAGCAGATATCGAGTCGCGCTCGTGCTCGGCAGCACACTGACAAGGTAGTCACTGTTCGCAAGTATATCATCCAAGTCTGTCGTGATTCG
ATCAGCGCAGAAAGCCAGATTGTCAGCCTCCTTGGGACTTGAGTGGCGCTTGAAGCCCACCACGTTGTACCCGGCAGTACGCAGCATCTTACCTACACCT
TGGCCAATGTCACCAAGTCCCAAGATTCCAACCGTCACAGACTGCGCCGACCGGTAGTTCACCAGCTCCATCCGCGCAAACTCGCGCTTGCTCTGGAATT
CCTTGGCTTCCAGCAGCATGCGCTCGATCAGAGTCACATATCCGAAGACGTACTGTGCCATGATCTTGGGCATGACACCTCCACCCCGAGTCAATTGGAA
CCGGGGAAGCTGATCCAGTTTCGGTCCGTTGTCACCTTTGGGCAGCAAATTGAGGTACATCTCGACGCCGGCGTAGGTGCCCTGCACCCACTTGACATTG
TCGAGGATGTGCTGCTTGTCACTCGGTAAACTCGTTTCGGGGTCGAGGAACACTGGACCTCCTGTATGTGAATCCATGACCACCACTTCCGCCTGTTCCA
CGACCTTGTGCTGCTCGGGCGTCAAGTCCCAACGAGGCTCGAGGAGGTCCTCTCCACGCTGATGCTCTGCATACCCGGCGTCCTGCTTGTTGCCTGGAAG
TTGCGGCAAAGGCATTTCCACGAACTGCAGACCCCCGGACCTGAAAAGTTTTCCAGCGGGTGACGAGGACGACGCAAACTCTTTTCGCACAGTGTCCCCC
ACTCCGCGGATAAACGACACAATGGGAACTCGAAGTGCTGCCATGGTCTCCGATATCTCAAATGTGCGGTGGGGAGAATCAACTTCCAACAAATCTAGGT
TTGATTTGCTAGGATTTCAACTAAGTGCGAGTTGAAGTGTACTTGAATGTCCAACCCTGTTTTGGCCTTCTAGCTGTCTAGGTGTCTAAATACATATAGG
CAGTGTCTGCCTGGTTGCTCTACTCCTTGTCGTTCGCGAGCGGCTCGAGGACGGCACCCCACCGAGCGTCCGTGGCAACGCGCACGGCAGCCTCGTAGCT
CTTGCTGTGGGGGCGTCTCGAGCCAGTCTTTTGAGCAAAAGCAGGGACGGCGCGCTTTGTCTTTGGAGCAGCAGTCTTGCGCTTGGTCACACGCGACGGG
ATGCCACGCACGCTGGACCCAGGCGCACCAACAACGCCCAAGCCCTCGTCAAACGAACGCTTCACGAATGCCAGCTCGTTCGCGAGCATGGACGGCAGGT
GCTTGTGCAGCTTGAGCAATTGATCCGCCATCTTTGACGACATCGGCATGCCGTGACGGTGGCAGAAGAGCGCAATGC