Description :
From Genome Similarity Track
Location :
Scaffold_6:165547- 166860
Transcript NameFunction/comments
Aphas_H257_04000protein kinase

Sequence
1313 bases(100 bases per row)
TTCCGAGATGGACACGACCGACAGCCGCATCGCGAGCGCGGCGCTCTCTTCGTCTTGCTCGAGCAGCGCTTGCTTGGCACGTTGGAGCCACGGGTGGTTC
TTCAACTCCGCCAACGTGATGCGGGTCTCGGGGTCTTTGTCCATGAGGCGGCGCAGGACGTCGAGGCAGTCGTCGTCGACGTCGGGGGTCGGGATCTCGA
GGGCGTCTTCGCGGATACATTGCATGATGGCCAAAGCCCCGCCAGTCATTTTCTCCCGCGAGTGGGCAAACGGTAGGCGGCGGAACAGCATCGCATACGC
CGTCACCCCCAGCGCCCACACGTCCACTTTGAACGGATCGTACGCCTTCCCGACCGTGCATTCCGGGGCCAAGTAGTGGTATGTGCCTTCGGTATTTTTC
AGCTCGTTCGCGTCGTCGTCGGCAAACATGTGCGCGACTCCAAAGTCGCTCAGTTTGTAATGGTCGTTCGATCTAAGAACGTTCTACGAATGTTCTGGCA
TAAGACGACCACGTCGTTGTGTGTTGCCGTTGCTTACCTCGGGTTTGATGTCACGATGGCATATTTGATTGGCATGGACTAGGAATAGGTCGAGTGGTTA
GAAGAACTTCACAGAGATAGTGCAAGAGAAAACGCACGGTATTCCAAGGCCAACGCAATGTCTAACACACACGTTTGTACGACCGAGACCGGCGCCGGTT
TGTCTTCGCCTAAGTACTTGTACACCATGGCTTGTTGGTCCCAGTCCATCACTTGGCCGCCCGTGACCAGTTCCAAGACCAAGTACATCTTGTCGTGCTC
GGCGTCGTCGATGACTTCGTGCAGTTTGGTCAAGTTCGGGTGACGCAGTTTCTTCATGATTGCCACCTCCTTGACGACTTTGTGGAACGCGTTCGAATGG
ACGGGCCGGCCGTCGACCATTTTGATCTCGCGCTTGCGTTTCAAGAACGATTTGTTGAGGATCTTCAGCGCCTGTGCAATTACGACAGAAGAAATGTGAG
ATCGCCGGCGATGGGAGGATGTTGATATATGTGTGGATGTGTACGTAGTTGGTGCGGAGAAAGTCGACGGTCGTGTGACACAGGTACACCTTGGAGAACG
CGCCTTCGCCCAAGAACGACCCAACCTTGTACTCGTTCACTTGGCTGGGCACTCCATCGTCGTTCTCCTCCACTTGCGCGACGTCCGTCTGCTTCACTTC
CTCGTCCGCCGTGGCCATCGCTCCAGTTGCTTGCTTCTCCACCTTGTTGCAGGCACGAAAAATGCCATTCGTCAGACTTGGCTCGAGTTCTGGCACCAGC
TGGCTCGACATTT