Description :
From Genome Similarity Track
Location :
scaffold_60:165526- 172840
Transcript NameFunction/comments
g6715.t1 hypothetical protein PHYSODRAFT_349212
g6716.t1 hypothetical protein PHYSODRAFT_552366
g6717.t1hypothetical protein
g6718.t1 hypothetical protein PHYSODRAFT_472278

Sequence
7314 bases(100 bases per row)
TCTGGTACCATTTTCGTACCTTATCCGGTCACTGCACAATAATGATCCTACCGCGAGCCAAGGGGAAGGACGACAGCGCGGCTGCGGGAGCCTCCGCCGC
CGCCACCATCTGCGAGCTGTGCGACCTGTACACGCACAACGACCTAGACGGCAAGTGGATGGAGCTCGCAGCAGTCTACGACGTACGTTAGCTCGTCGCC
CATCGACCCCACACTGCCAACACCTAACGCTGAGATGTGTCAATTCTTCCCTGCAGCAACGCCATAATGTCGACAACTTCCGGGAGATTCTGGATCTGAG
CAACCCCGACGCACGGATGGGCGACCTCAATGGCTGGCACTTGGAGCGCATGGCCGTGGGGGAGTTTGAGCCGGGGGCAGGCGCCAGCGCCAGCGAATTG
GCGGAGATCAAGCGTGAGAGCCTCCTCATCAAGCAGACGCTGATGAAGGTGATGGCCAATGGCCGCAGCTTCAAGGCCAAGAGAGACGATCTGGAGGCGG
CCATGGCCAAGCAGCGTGAGGAGCTGTCTGCTGAGCTATCTGAAGCCAAGGAGTTTCTTGGCCAGGCACATTTGCTGAACGCCTGTGACTCGGCTGCGAT
CGAGGTTAGTGAGCCAGCGCCTGTGGAGGAGCGACTGCGAGCGACGGTCAAACATCCAGAGCTCTCGCCGACAGTCGATCTCAGCGAAGCACCGTCAATC
TGATGTTGTGAGACGTTAGATGGGGAGGTAAGCGAGTGTGGAATGAAAAACAGGGCGATACACGAGTGCATTCCTCCGGTGCTCTCCCAAATCGGTCACG
CTCTAACTGTAACTTGGTTTGGGGCCACCTGCTCCGTTCTCGCCCTCCTGACTGTCTGTACATGCCGCTGTTTGCTACTGCTCTAGTCGACGTGCAGACG
GTCCTCAAGGTACTTGACGGCGTCCTTCGTGATGATCAGCAGGTCCTTTTGCAGGATCGAGTAGACGTTGATCTTGTTCTGCGGGAGCGTGTCCACGTAC
GGGATGTTGCGCGTCGCCAAGACAAAGCTCGAGTCCACCTCCTCGCCGCCAACGAACAGTGCGTGGTCCCAGCCGCGGCCACCAAGCAGTTTCTTCATCT
CCTTCGTCTTGGTAACCTGTTCGACACATATACACCACGTCAATATCAACTCAATAACCACGACAACAACAGCAGCAACGTACGTCAACGTCAAGCGAGT
CCACGACGGCCAGCTTCCCCTCACGGAGCTTGGTGGACAGCGCCACGCGCAGGCCCATGGCGCGCACCTTCTTGGGCAGGTTGTACGAGAAGTCGCGCAA
CACGGGGCCGTGCACGCGGTAGCCTCCGCGCCACTGCGGCGCGCGGATGTCACCTACGCGGGCGCGGCCCGATCCTTTCTGCTTCCACGGCTTGCGCGTG
GAGCCGCTCACCTCGGAGCGCGTCTTAGTCTTGTTGGTGCCGGCGCGACGGCACGCGAGCTGCCAGCGCACCACGCGCTGCAGGATGTCCACGCGGTCGG
GCGCGCCGAACACCTCGCTGTCCATTGTCACGGAGCCCAGATCCTGCGCGTCCTCGGTCAGCGACAGCAGCTGCAGCTCGAGGTCACCCGCGGGCGTCAC
CTTGACGTCCTGCGCGGCCGCGATCACGCGCGGCGGCGGCTGCGGCTTCTCCTCGGCCAGAGCTAGGTTGGCCGGTGCGTGCGTGCTGGCGGCACGCACC
AGACAGGACGTGCGCGGTGCCGATACGGAAAGCGCCGCCACGCCGCGCAGCAGTCGGTTCATTCCCACAGTCGCCATCGGTTCCCCTTTGAGCTGCTCTT
TGCGTGCGGCTCTGGTTGCGAGTGGATGGCGTCCATCTTGAGGTAATGGTACACCATATTGGTGTAAAAATACACACTCTTTGGTGACACAAAAGCGGGG
GTGGAACAGGCACTAAGCAAAAGTCAGACGGCTTTCCCCCGCATCATGGCGTCGCAGAGGAGAGGCTCCGCCCCGCGCGGGGACGGCAGCCTGGCCGCCA
TCTGCACGCTCATCGAGCGCAGTACCCTGGACCGCAAATCCAAGCTCGACAGCACGGGTCGTGTCTGCTACGTACGAGGAGATGAGCCGCCCCTGCGCAC
AAATACTACCGATCTAATGTTTGAATACTATTGTAGGAGCTCAAGAATGACCCGTTGCTGCTGGACAGCTTCCCCATGGACCGGATCATGAAGGCCATGC
GCCGACTGGTGTGTGATTCGGACACGTCCACGCGCGCGGGGGCGCTCCGAGCGCTGCGCTACGCCATCAGCAGTAATGGCAGCATCAAGCACTTTGTGGA
CCTCGTACGGCTGCCTCCTGCTGCTTTAAATATTGCAGAGAAGTTAATAGTTGTGTGTTTCAATTGCAGAATCTGCCGGTGTTTGTGGTGCGGTCGCTGG
AGCGAGAGCAGAAACACTTGGCGGAGAGAGTTCAAGCGCTCAAGGTGGTGCGACGCGTGATGGAGATCGATGCGGCGCAGATGCCGACGGGTCTCGTGGC
GTCGTTGACGGCCGTTGCTGGACACAAGGACGACAATATGCGTCGAGTGTGTCTGGAGACACTGAGAGAGCTGGCGCTGCTGAACGTGGAGGTTGTGGCG
GAGGCGAACGGCACGAAGGTTCTGGTGGATGCGATTCTGGAGCCATCATTCCAGGATCTGGCCGACTCGCTGCTGATGACGCTGCTGCTCATTCTAAACG
AGCCGTCGACGCGCAAGTTTATCGAGCCTTTCGTGGATTCGCATGTACTGTTGGCGCCATTTACAGATACGGATCTGCCAGCAGGTAATGAGCGGCGACA
GCGGTGGATGGCCAGTCGTAACGCCATCGTGACGATGATGCGCTCGTGGGCAGGCATGGTGGTGCTCACGAGTAACCCGCAGGGCTTGCACTCCTTGATT
CAGTTATTGGTGCGACCGGTGGGCGAGGATGTCCAGAAAGCAGTACTGTCAACAATTTGTGAGATCTTTTACAAGAAGACAAGCTTCGACAAGTCCGCGA
CCGATGCAGCAGACACACCGGCACTCCCTATTACTCTGTCGAGCGCAGAGCAACTGCCCCTTGCAGTCAACCACAATTTGCTGGACAACTACACTGTAAT
TATTCTGCTGGCCATGATTCACTGTGGCATCCTGGAGGCTCTGGTGACTCTAGGTGCGGGTCCGTCTCGAGCATTGGCAGAGCCGGCAATTGACCTGCTG
GCCGATATTCTGCGTATGGCCTCGCGCCTGCTGCCGGACCAACACTGCGCGTCTTTGCTTGCGCTCCCCCGCCTAGTTTCGGCAACTTCGCTTACAACGA
CCACCACAATGACCCTGGGAGATCACGCTAAAAGTCTTTTGGAGCGTCTTCAGCGTGAAAAGTCAATTCGGGCTAGTGAAATGCTGGGTGAGCTCGCTAA
CGCTGTCGGGGCCAATTCAGGTAGCATTGCTACCCGTGGTGTGTCGCTAGTCTCGTACGGTGGCAGCGGTGTTAATGGTGTTCAGCTAGCGTCCGAACTA
CTTCGCGACACTAACCGACCATCGAACCTTCTCGCTCTCCAGCAGATTGCAGGTGTGGTGCGTCTCCCATCATCTAGCGGCGGAGGTGGCCTTGGAGGAA
CTGGCAGTAATTCTGCCAACTATGCTGTGGCAGCCCCCTCAACACAACGTGGCACTAAGAGCGCGACAGCGCTACTAAAGGACAGCTTGACATCTCGAGA
GCTGATGGTCCTCGAGCTGAAGCAGTCATTGGATGCACAAATGGATGACAGCACATTTAAGGACATGCTGCACAACCGTTCACGGGTGCTGACGGACAAA
AACTACAAGAACTGGAACTGGGATATCATTTCGGAGATGCTTGAAGGCCCACTTACAAACCCGCAGCGACTCTCAGAGGCGATGAAAACCAAGTTCTTTA
AGCGCCTTTCAGGTTTCTTCCGTTGCGACCAAGGCAACAAAGGATACTTTTCGAATCTGTACTGGATCCCAGACCACGTTCCCTACCTGCGCCCAGCGTG
CCAGATGTACACGCTGCTGTTAAACCACCCCGAAGGCTTGCTCTTCCTGAAAACTGATCGTCGTGGTCAATTGCTCACTGAAATTTCGTCTGCACTAGAG
CTGGAGGCACGTCCTGAGGCTGCTATTGTGGAGTCCCATATTGGCGTGCTAAAGGCGCGCATGTTCTCTCCTGATTATGTATCGCGGCGTATGCTACGCG
AGTACTTCACACTTTTGGGACTGATGAGCTCAAGCAAAGAAGGTCTCAAGATGATGGAACAGTCAAACCTGTTCCAGCGGCTCTACGTCATGGGCACCAC
AAAGGGACACGATTTCTTGTGTCGCCTCATTCTTGCCAACCTGGACTACTCTGTTGATGGAAGTTCCCGCAAGTTGCTTCAGTCTTGGATGATGGAAGGT
TCGAAGGCGCTGCGTCTGTATGCAACGTGTTTGCTGCGTGCGTTGCTGCGCTCTGAGGTGGCCGATTTTGATAAGTGGGGCATTGATGCGCTGGTGACTC
AGCTCACACAGGAAGAGGAGGTTGCCAAGGCCGCACTGAGTGTACTTGAAGAGGCCGCTGAGACGCCCGCATGCCTTCTGGCGATGATTCTGAAGCGGCC
TATGAAGCTCATTCAGCTCAAGGATAAACGAGCAGAGTCGCTGCTTTTGAAGTCGCTCTCGCTTCCTGAAGGTCTGAACTTCCTGCGCGACACAGGCGAT
TGGATTCGGCGCACTCTAGCCGCCTGGCGTCGCGAAAAACATATCTCGTACGTCCATGCGGTGGAGCACGCGCTCTTCCGTGGTTTGCACCGCGATGCAG
CGGGGCGTGAGCGTGGTTCGAACAGTGGTTCAATAAATGCACGCCAGACGTGCTCTCCCACTCCTATCCCGGTGAATGTGCCCATGAAGCGAGGTGGCGG
TGTTGGGCTCAAACCGCCTAGTGGTGGAAGCAGCCAGCGATCACTATGGGGACTGGATTGGCTTTACCGTATGCCGTGGAACATGGAGGTGAAGATTGTC
GGGCCTCCAGGAAGCGGGCCTCCCTCGAGCCTCATCTTGGAAACGTATATTGATGGTGCTATGCGCGACGAGGATGAGACGACTGGCATCGATGACGAGC
TTCGCATGAACTCGATTCGTGTCAAGGGTATCGTTGTGGACGCACGCAACATGCCACAACCTGTGGTTGTGAACTCGCAACAAACATTACAAGCTTGTCT
TTTCCTGGGTACGCAACCCGTAGATCGGCGGGGTTTCACAAAGCCTCCCCCGCAAAGTAATGGAGGCTTCGTGTCCACAAGCGGATCAGCCAGTGGTGGA
GGCTCGGGTGCTCTTTCGAGTGATACGCAGCAGAAAATGCTACGAGCGCGGTCAGCGTCAAACTCAGCAGGAGGAAGCATGGATCGCTCCTCGGAGACAA
TGATGTCGTCGCTTGACTTCGCTGACACTGGGTCGTCTTCGTCTGAGGCAGCAAAAGAAGAGAACAAAGATTGGAGCTCGTGCCAACCTGAACAGCGCTC
ACCACAGTACTTGTCGGCACCAGAATGCTCGCTCTGTGCTCCAGGTGAGCGTGCGGTGTGGAACTTCCGTGTGGAAATGGACTCCGCGGCAGGCAGCAAC
ACTTCAAATGGCAGTGTGAAGCGTCTTATGCTCAAGTCTGTCGAGTTCACGTTGCAATTACTTCCTCTTCGTCCACGTACTGTGCCGCTGCCGGTACACT
TGTACGGTGAACTGGCAAAAACCAGCGCTGGCTGCCAGATCCTGCACGCATCTGGGCACCTACCGGAGTTCCTTGCGTGCCTACGCGATGCTGCTAGTGT
CCCGCTTGAGAAGCGTGCTGCATTGTGGGCGCTCGGCCATGTGTCTGCCACACCGCGCGGCTACGATCTTTTAAACCACTACGCACAAGATTTTGTGGAG
ATGATTGTCAAATTGGCTACGGACTCTCCGCTGGTGTCGATTCGTGGTACTTGTTTCTTCGTACTGGGATTACTCGCGCGATCACCCGCAGGACGGCGAC
ACCTTGCACGTTTGGGCTGGGATGCCCCACGGGATGCATCGCGTACATCCATCGCAGTCCCGCAGAACTGCACATCTCTCTTCATGTGGCCGCCGTCTGG
ACCATCGAACCCATGCCCATTGACACAGACACCGCGAGCGTCGCCCCTACAACGATTGCTGGTGCGCAGGCGCGACAAGATACCCAACGATTGGCGTGAA
GTGCTGCGTTTTGTCGCGGACCTGAGTAACCACATCACGCAGAAGGAGGCCCATGCTTCGCTCAACAAACTCCGTTCATCGAAATCCGAGCTGTTTGAAG
AGCCGGTGCTGCTGATGTACGTGCACGCGCTACTGGAGAAGTACAGCTACCGATTGGCTTTACGCCAGTTTGTGCTCAACGCGTTCGACCGAGCAACACT
GACGGATGAGGTGCTTGACACGCTTCGAGTCGAAGACGAAGAGGAGCAGGGGAACCAAACGCGTACTGGCCAGCGTGTACCCTCCGGGCGGGAGCTGCGG
CGGCGTCGCTCGTCGCCGTCGATCCCTTCATTTACGGCTTCGGTCCAGTCGCTCAACTCTGCCATGCAGGCAACGTCTGGTGTGTCGCGCATGTCGTCCA
TGCAGAACGTCCTCAACGGTGGCAATATGGGCGACCACCGTTCCACGATGCGTTTGAACGCGCACAATGACCCCATCGATCGCACTGTGCTGCTCAAACG
TAGCCGCAAGCGCTCTGCCTTCTCGGAGAAGACCATTGTCGTCGGCGCACCTGAAGCTGCTGTGTAGGTTAGGCTAAGATATACCTAGACGATGAGCTTG
GCGTAGCGTTTGCCAGTCGTTATTCTTTGGTGCACTATCTCTATTGGATTTACCTACAAGAACCTCCCAGAGGCCATGTCCATGAGCGAGTCACCCATGT
GGAGAACATCGAGCTTGCACAGCTTCCCGTCCAGAGCAGTGCACATGGTGATGGCACCTCTCAGTGTCTCCAGGCCGCTCCGTTGCACGCGCAGCAACGC
CGTGCTGGGCTCTTTGCTGTTGGCAGCTAATTTATCAAATGATAGGATGTCGAACTCACACGCCGAGGCGCCTACCACGCCGAACGCCGTCTTGAGAGTG
TTGTCCAGGGCGAATTTCAGGCGCTTCACGTCGCCCACAGGCACCGATCCGTCCTCGGAGAAGCTGGGAATAGAGATCAATATAAATTAGGTACTGGTAT
ATATCTAGTGATCTCTAATAATCCGTAATGGGACGTACATGGCGATTTTGAGGTAGCAGTGCTGGCCCTGCAGCGAGAACTTGTGGTGCGGCGCCGACGC
AGGTGCCGCCATTG