Description :
From Genome Similarity Track
Location :
Scaffold_101:165519- 168191
Transcript NameFunction/comments
Physo_122159hypothetical protein

Sequence
2672 bases(100 bases per row)
ATAAGTCCTTGCGAGGGTGCCCGTGTTAAACGACACATTCAGCTGGTCGACTTCATCTTCACAAGGCGTTGCTCAACCTTGGGGGCAGCAGCCGAGCAAA
GGCCTGGTCGACGGCGCCTTGAAGACCGTACTGATAATGTTGACATCGTCGCGAGCGCTATCCATAATTGCAAGAGCCAACCCTCGACTTCTGCACTCAG
CTTGTCCGACGTATTGCCATACTGTACCATGATCGGGCCTCTAGTATTTCGACGCTAAAGTTAACAAACGATAAGGAGGGGTCGAACGAGCAGTGGCAAA
GCCAAAAGCTTGATTGTACTTGTTAAAGGGTTAATAGCGGAGGAAATTCCGATGAAAACAGCTATCCCTCGCAAACAGTGCTATCGAAGGGTGATGCATT
TACATGCGCTTATGGGCGCATTTTCTTGTGTAACGAGCACTCGCCTGGTGAGCGCTCGCTAAACAAGGGAATGGGCTCGTAAACGCAGGTACTTAGTAAA
CGTTTTCTTCTTCTTCATGACTCTGAGAACTTGGTGTGCGCCGGATCTTGCGGGTTTACGGTGTCGGCGAGAGGCCTGCCGCAACGCAGCCAGCCATGCA
GGTGCCCAGCGCGGCGTTGCAGCCGATGACCGCGGGGATCGAGCCGACGCCAGCCGTGACCGTGCCAAACACCACTCCGGCGGCGGAATAACACGCCACG
GCGACAGCATTGCAGCCGGTCTGGCAGATGCCATACGCGAGGGGGCCCGCGCTAACTTCGGGCGCGGCGGCGAGTCCCAGGGCGACGAGCACAGCGGCGA
GCTTCATCTTGGATTGGGGCTTGGATTGGTACTTGAGGTGTCTTCGGCGAAATCCAAAGTGAGCATTGTTGTTGTACTTAAGTAGCTGATGCTACACTGT
GTAGCCGTTGCCGGGGTCTAGCCCAGCAACACCAACGCGCTGCAGAAGATGAACAGCTGCAGCAAGTAAGGACGGTTGCTCAACTGATCAAGTATGGACT
GTTATGCAGACGCAGCAAGTACGGACGATTTGTGCCACCAGAGTGGTCACCTCCAAGAGCATGCATAGGACAAGAGCAGCTACTGCAAACTAAGGAACCG
CTCAATACATTTCACTTCTGGAAGCGACACAACAATTGTGAAGCCTCGAGTCGAGGCCCTCCGGACCTTAATCTCAGCTTGAAGACGTCGAAGCTGCGCA
CGTGGTCGCTGTGCATTGGACGCGAGATGCATCGTGGGATATCCCGACTCTTGTTGAGCAAGTTGAAGAGATGATTCCAATTGTGCCCAGCGTGCTCCAA
GACGGATTGAGGTCAATTGAATTCCATCATAACGTTAGGGCGAACGACCACTACTGTAAAGCAGTGAGAAGTCTGGCGTTGATTTTGTTGTTTTTAGGAA
TCCCTATCACGAGCTGTAGCAGCGCTGAGGCGGCTACTGGAGAAAGACGGGTCCATTCGCATGAATTTACGGGTTCATTGTCTTGGTCAACCGGAGCACT
CCTGCACAGAGCGGAAACGCTCGTCAAGCAAGATAATGAACCCGTAAACGCATGTAAGTGCACTCGTCTTACCAATCGGGAGCTCTCGCGATGCTGTCAG
GCCCAGCTATGGCGTCGGTGCCATGCCAGCCGCAATACAAGCTACCGAATGCAGCGTTGCAGCCGACCACAGCCGGTAGGAACAGAACTCCGGTTGACGA
GTAGCAGGCGACAGCGGCGGCATTGCAGCCAGCCTGACAGAGCCCGTAGGCCAGTGGTCCCGCGTTGACTTTGGCAGTACCCACGAGCCCCAGCACAATG
GGCGCGGCAACGAGTTTGTTCAGCATCTTGGCTTGAGGCTTGAGTATCGAGCTTTCTTCGGCAAAACAGGAAGTGAGCTCCGTTGGATGCTGAGCGAAAC
TCGGCCTGTGGTTGAAGGCATCTTTCCGAGTAAGTCGATATTGCCAACTGCCTTGAGGTACCGAAGTTTCCTGGGCTACTGCTTATAGTACAGTTGAAAC
CCAAGAAGTTGTATACTTTGTCAACGGGATCAAACTTTAGACATCATCCATTTCGCTTCCTGGCAGTGAAGAACGACCCACATTGTTTCCAAGCGTCACC
AAGATGCTGAAGAAGCTCACTGCTGCGCTCGTAGTCCTGGGGCTTGCTGCTGCGGTCAACGCGGGCCCGGCGGCCTACGGGATCTGCCAGACTGGCTGCA
ATGTCCTTGCCGTGGCGTGTTATGCTGCCACTGGGGCAGTCTTCGGTACAGCCATACCGGCGATCATCAACTGCAACAAGGCTCTGGGCGTGTGCATGGC
TAGTTGCGTTGCGGCTGGCTTGATACCGACGCCGTAGCTGGCAACGCTCCAAACGGGTAAGACGGATGCATTGACCTGCTTTCACGGGCTCATTCGCTTG
ATGAACGAGCACTCCCGCAGCGACCAAGCGAAGGAACCCGTAAAAGCATGTGACTGATCTCGCCTCCTCCAAAACCTACGTGATGATGCTGAATAGGACT
CGATCGAGCGAGACGTATTTCAGTGAGTAACCACGAATCAACTTCGTTTTGCCATTGCGTTGGCTTGATTCGTGACAACATTTTTACGAAGGTGCTGTTG
CAGATCACAAGCAGGCAGGGCACCATGATCCGTGAATACAACTTCAACGTGGCTACAACTGCTGCTGGATAT