Description :
From Genome Similarity Track
Location :
Scaffold_5:16549- 17713
Transcript NameFunction/comments
Physo_334427AlNc14C579G12208

Sequence
1164 bases(100 bases per row)
GCTGGCGGAGTCGAACCAGGAGAGGGTTGGAACCGGTGGCTTCTTGTTCGAGTCCCACCCGCTGAGAACACGTGCTACTTTCTGGTCTTCAATGGTTGTG
TTGAACACGTAAGCGAAAGCCTTGTTGGTAGCCGTCATGTTCCACGAACCACGATCGAAAATCCACTGAGCACTGAGCAGTGGATCACCGTTTGCATGCT
GAGCCCCACCACGTCGAAACGAGTGAGACGTCAAGTTTGCAGTTGGCACCGCTTTAGCTTGAGCGGCAGACGCTGTCTTGATAACGCGGTTCACGTAGGC
GTGGATCTTCATGTTTTTTTCAGGCAATTTACGCTTTTTCTGAGGCGGCTCACTTGGCGTGTCGTCATTCTCACAGGCAACAAGAGCTTCAGCTAGTGGC
ACGTCAACAGGGGCTGTCATACTCTCGTCGCCGCTTGCGGCAAGGTGCGGAGGATCCAGCAGCTGTGCGCACGGAGCGTCCTGCATCACCAGGGCCATCG
CAATCGCATGCAGGGGGCACGTGATGAAGCTGTTCTTGTCGAGAAAGAGAGAGATGCCCTGCTCGTCTGAAGTCTTCACGCGGATGAGCCGGACGAACAC
AACGCCATCCGCATTCACAGACAGGTTTCCCTTCACCACGAACCCCAGGTCTGAGGCGCGGCCAAACGCGTACCACATCAGCGCCAGTAACGCGGCATCT
TGGTAGTCCTTGGGGCTGGCGGCATCATAGTAGAGTCCGTCCATGAGAATTCGTAGGTCTTCCTTCGTGCAGGCAGGCGCCTTCTTGACCATTCCACCTT
CGATGCGCTTCAGACAATGGCGCTCGAGCGTCTGTCCCATCTTGAGTAGTTTCTTCTCGATGGTGGCTCGGTGGGTCGGGTAGGTGTCGAGCAGCCAGTT
CTTTACATGGCGGTAGTAGCTCATGACCGAGTTCTTGGCCAGCGGCTTCCCTCCTCGGCCTTCGACGAAGGCGAGGTGAACGCCATAGCGGTCCATGAGC
TTCACAAACACAGCCCCACTCTCATCATCTGCGAGAGAGGCAGCGATGAAGTCCATGGAGACGCCTTGGGCCATGACGAAGCGTCCGAAGGCGTTGATTG
CGGTTTGTAGAGCGCGCTGGGAGTTGACGGGGGCGAGGTCTTGGAGGCTCATACTGGTTCCGAG