Description :
From Genome Similarity Track
Location :
Scaffold_7:1654658- 1660267
Sequence
5609 bases(100 bases per row)
GCTGGTTTCGAGAGATCGACATCGCCATCGCCTCGAGGTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGCGGCTGTCTGGGAAAGCCAA
GGAATGGGCTCTCGGTAAGTTGGTTGTCGATCCCAACGTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCGTTCGAGCCGCCGCAAGAT
GAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGCAAGGCACGATGACGATGCGCGACTACGTCCAGAATACACGACACCTCGCGTCGTGCATCGTGT
CTAAGCCGATCGATATGGCCTCTCAGGTTCATGTATTCGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTGCCTTACAAGATCGGACCCCTCTACGCT
CGAAGAGGCATTCGCCCTCGCACTGCGCGAGGACTACGTGGTTGCGGCGTCATACGCTCACGCTCTACCTGCTTCTGCTCGGGGTCTGCGCCCGAGCCCA
TGGATATCGACGCTATCGATGCGACGAGCAATCGTCAGCGTTATGCAGCGCGTCGGAGCGGTGCTCGGAACAATCGTTCTCTCACCTGCTTCCGCTGTCG
GAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGTTCGGACCAGCCAAAAAACGGTCAG
GGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGTCCCCCGGTGGCAGCCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTTA
TGCCACCACCACACCGAGCGATTCAAGATTGATCATTGTCAGCCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGCGCTCCTTGATTCAGGAGCGACC
AGCAACTTCCCGCGCGTCGTGCTTGTCGGTACTCCCGTCGGACATCACTGTCCGCAAAGGTAGAGGGGAGGTCGCTGTCAAGTTGGCCGATGGGAAATCA
CGCCGCGTCGCGCGGCGCGAGATTACCCTTCCGTACACGTTCGACGGTTTCCGAAGCAACGACGACTTCCTCGTCATTGAGATGAATTACGCGTTTGACT
GCATCCTGGGTATGCCGTGGCTGACGCGCTATCAACCAGAGATTGACTGGTTGGCCCGGTCGGTCAAGCGTCGCAGTGATTATGATGTGAGCGAGGTGTT
CACGCACCTCCTAGTCGCCCAGAAGGATTGGCCTCACGTCACCGTCGTGGACCGGTCATCCACGACGCACGTTGTGCACAGTGTGAGCGATGGCCCTCTT
TGCACGGCTTGCGCAGTGCTGTCAACTGACGAGTCCCCGCGGCGACGCGGGGATGTAGACCTACTGGCGGTCGAGCAGGGCTCCCGCAGATGTACGAGAC
GGCGGTCGAGCAGGGGCTCCCGCAGACGAGCGAGATGGCGGTCGAGCAGGGGCTCCCGCAGATGAATGAGATGGCGGTCGAGCAGGGGCTCCCGCAAACG
AAGGAGTTGGCGGTCGAGCAGGGGCTCCCGTCAATTGAGCCGGTGGTCGAGCAGTTGGCGCTCCCGCTGAACACTACCGCGGTCGAGCAGGGGCTCCCGC
TAGAGGGGGGTGACCTCTCGTCCAGCGAGAGCGAATCATCATCCTCGAGTTCGCACTCGAGGCGGCGGAAGTCGAAGCGGCGTCGGCTGAAACCTCGCCG
AGAGCCCGTGTTAAGTGACAGCTCACCGACGGAGTCGTTCTGCGTGCTTGAGTACGTCGAGGTACTCCCGGTCGCCGACGAACACTCGAGCTTGCAAACC
CACCTTGCGAGGGGGGTCGATCACTCGACTTCCAGGTCTCTCCTGGAAGAGCTTCCTTCGCAGCCTCAAGCACGATGAAATCGAACAGGTTTGCCTGATC
ACCGACGCCGATTCGCGTCGCTCGAAGTGAATGCATTCAGTGACGGCGACGCTCCCTCGCGCCCAAAGAGCGCTGAGCCGAAGTCGGCCCGCGAGGAGCG
CTTCGCAGCGCAATCTTGGGAAGCGCTACGCGAATCCGGCAATCCAGTCTACGAGTCCGCCCGCGAATATGAAGATGTCTTTCCGGATAAGATCCCAGCT
GAGCTACCAGCTGACCGAGGAATTCGCCACGAGATCGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCC
AAGCTATCGATGACTTCTTCGAGAGCCGCCGCAAGGCGGTCATGTGCGCGAGAGCACATCGCCGCACTCCAGTCCGATTTTCTGTGTGAAGAAAGCCACG
GGCGGATGGCGCATCGTCCATGCCTTCAACAAGCTGAACGACGCTACCATCCCTGCCCAGACGCCGATTCCTCGGAAGGACATGGTGCTCGACGCAATGT
CGGGTAGTGAGGTCTTCAGTGCCATCGACTTGACCGATGGGTTCTACCAAATCCTTATGAGGCTGAGCGACATACCGCTCACAGCGGTAAGCACTCCCAG
TTGTATGCTCTGGGAGTGGCTTGTTATGCCACAAGGCTTGAAGAATACTCCCGCCACGCTCAATCGCATGGTATCCCATGTGCTGCGCCCGCTCCGCGAT
TTCGCACCAAGTTATTTCGATGACATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAAGCATCTGAGGCAAGTCTTGC
AAGTGATGCGCGAAAACAAGCTGTATGCCAACTTGAAGAAGTGTATATTCTGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAACGGCGT
CCGGGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCCTACGCCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCAC
AAGAACACGAAGAATTACGCCGGATTGATCCAGCCGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGCCGTGGACTTCCGCACAACAAGCCGCCTTCG
ACTCGGTGAAGAAGAGTCTCGCCGAGGCCCTAATCCTCGCGCTCCCGGATGACTCGAAGTCTTTTCACGTCGTCTACGACGCGAGCGATTTCGCCATCGG
CTGGGCGCTGATGCAATTCGATGAAGAAGGTCGAGAGCGTGTCGTAAGCTACCAGTCCAGGCAGATGAAGCTGGCGGAGCGCAACTACCCTGTTCACGAC
AAGGAGCTCCTTGCGATGCGCTACGCTCTGATCAAGTTCAGAGTGTACTTGTTGGGTGAGGATACCTTCGCGGTGTACACCGACCATGCATCGCTGAGGA
CAGCGATGAAGAGTCCTCATCTCTCCTAGCGGATGGCCCGCTGGCTTTCGTTCTTCTCTGAGTACAACTTCATTGTCCACTACAAACCCGGCAAGAACAA
CATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACTACGACCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGATGTAGACGAGTGTGCC
ATGTGCGAGGCGACAGGAGTCAACCTGACGAGCGTCTTCCCGGTAATGTTACTTCGCGACGAGATCCGAGCTGCTTACGAACATGACTCGACGTGCTCCA
GTATCCTGAAGCATCTCCGCTCTCCCAGCGCCGACACACTGGGAGCCCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATCGTCTCGAGAACGAGCT
GCTGTCGTACAGCATCGACAACTTCGATGCCCCACGTGTCGTTGTCCCTAACGACCCCGATCTGCGCCCACGGATTATCCATGAGTTTCATGATGCCCCG
CTGGGCGCTCATTTCGGTCGCGAGAAGACATTTGCCGCTGTGTCACGTGACGTTTTTTGGCCACACCTGTACAAATGGGTACGTAAGTGGGTGCGCACCT
GCGAGACCTGCCAGCGCGTGAAACCTGCCTCGTCTTCGCAGGCTCCCTTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACTT
CATCTTCGGGCTCCCACCCGATGCTACAGGACGTTCCGGTGTCTTGGTATTCGTAGACCGCTTCAGCAAGATGGTTCACCTGATTCCGGTGTCGATCACC
GCGGCAGATACCGCGGTGCACTTCCTCGATGCTGTCTTCCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCT
TCTGGTCAAAGCTCTTTGAGCTACTGGGCTCGAAGCTAATGATGTCCACAGCAGCCCATCCGGAAACGGACGGCCAGACGGAGCGCGTAAATCGCGTCCT
CGAAGACGTCCTTCGAAGCTACGCGACGTCGTTCTCCAGCTGGAGCTCGTTTCTGCCACTGGCCGAGTTTGCTCTGAACAACGCGGTACACGCGTCGACT
GGGCTGACGCCCTTCTTCGTTAACAACGCGCGACACCCGCGTGTCCCTGCTCTTCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCCACTCTGGGTG
GAAAAGAAGCTGCCGACAAGCCGTCTACTCCATCTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACCGGTACATACACCGGTTGCTAATGATAT
CTCAAGTGTATCCCCTGTTACCACGTCGGTCAACGCAGTGACACGCTCCGCATCGAGCCCACTTGCGCCAGCTAACTACGCGCCGAAGCATGCGGCGCGA
CCAATCGACTCCGCAGTCGTCTCCGACTTCGTACTACAGCGCCAAGCGGTCACCCGCTATGTTCGAGACGCACTGCAGGATGCAGTGGACAGGCAGAAGG
AGAACGCCGATAGGACCGGCCGCAAGAACACGGCCACGTTTACAACAGGCGAACGCGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGCTACCAA
CCTCGGCGCGAACAAACTCGCGCCGCGCTTTATTGGCCCATTTACGGTAATCAAAGCCATTGGTGATGCCTACACGCTTGACATTCCTACGCCACTACGT
CTGCATCCGACATTTTACGTCGGACGGCTCAAGAAGTATCACCCAGCTACGATTCCAGAGTCGTCTCAGGCTACTGAGCCGGAGCATGCGTCGAGCGACC
TTCTCGACGGGCGCGGCGAGCCATCGATCCATCCGCACCAGGAGTCGGATCTCGAGGCTGTGTCCCCGTCTGCAAACGTTTGTGAACCGACCTCTCCAGC
ATCTGCAACCGAGCAAGGATCTCTCGGTTCGACTGACGCAGCTGCGCGCTCTCCCCGGTGGCCCGGGCAGTCTGATCGAGAGCCTCATCCAACTCCTGCT
GGGCATCCCAGTAGCTGTTCAGCAAGTCGTTCTCGCTATGGGCAGCCAGAGCGCTAGTGCTATCGACGCGACGGCCTCCTCCTGTTGTTGACGCTGCCGG
AGATACCCACTGGATTGTTGAGTACATCGTTGCCCACGAAGATCCACTTCGCGCTCCCAAACGTCATCGTGGGCTCGCCCAAGATGTTCCGGTCGACCGT
CGCTATCGGGTACGATGGCTCGGGTTTCCTCCCGACGAGGATACGTGGGAGCCTCGTGCCAATTTACTTCGGGACGTCTCGAATGTGGTCCAGGCGTATG
AGTCCAGCC