Description :
From Genome Similarity Track
Location :
contig_67:165442- 167011
Sequence
1569 bases(100 bases per row)
ATTGGGACAAAGCCCACCACGGGTGAAGTGGGCGGGCTTCTTTCAAGCCCTGGGCTTATCTTGATTCGACGAGTTGAGGACGCCGGGGCACGAACCCAGT
CTCAGTACAAGGCCACCTCGAGCACGCGTAAAGGACCCTGCTTAATCCCGATAAAGCCAAATTCGACTGGGTTCGCCGACAGATCCTCCCAGTGAGCAGC
GTTGCAACACCATTCGTGGACAGCTCTTGCGGGGCGATTATTGTCAGCTGTAGTGACATATCGAGCGGGGCCAGCTGGAGCGGGCGCATGTCCTACGCCA
GCTCGTCACCGACGACCACGGAAGCGGAACACCTAGGGCTCCTCATGGGACTCAAGGCGTGCGAGAAGAAGCGGTACTGGCCGCTATGGGTAGTGAGCAC
GAACAAGATGCTGATTGCAACGCAAGCCCCCCAAGGCACGGCATTTAACACAAATCTACTGGAAGAGTCGGCGCATCGTGGATCGGCTCCGGGAAGTAGA
ATGGCTACACCACGCCAAAGACGCCAACCTTATGGCGATGGAGCTGACAAACACAGCGCTCGAAAGCAGAACGAGTGTACAACAGTACACGGATGACACG
GTCACCGATTCCGGGCAATGGAGGAAGGTACTCTGCCACCTAGATGGAGACATGATGCAATGGAAAACACACGAGGACAACGCGGCGCAAGCGGACGTCG
TGGCCGACAGCCAGTAAGGACGCCGGCATGTAACGGGGAAGCGTAAGCTTGGACCTGGAGAAGGCTAACTACCGACATAGGGGCGATGATTAGAACAGAC
ATAGGAAGTCGTTAGCACCAATAAGTGACATCAATGTACCTCACTGAGAAACGAAAACGAAACCATTCGTGGACAGCTCGCAAGATGTATGAATGTAGCC
ATTCCCCATTATTATAATTTGTGATGCTGCTGCACATCGCTCACGTTCTTATCGCTCCCAGTTCTTGGGCTCGTACACAGCCACACCCGGTGCCTTGCCC
ACGCGTCAACCTCCTCGCCTGACTGTCGTGAGGACCGAGTCCTTCTTCTCCGCAGAGCGTTCTGCGCAAAACCTTCAGCGTCAGCTTCACACCCTCACGG
AGTGTGACTCGGCTCTCCTCTTCGGCCATGTACTTGGGATGAGTGGTCCTGCTCTTTTCAACTGCAGGCGAGTGGTGCACAGGAGGCCCACCAATTTCCT
TCAGATGATCCGCGTCGCCAGCAACCGAAAGCAGCAAAACTTACGCTGTGTCACCAGCAACTGAGCAATAATTAGCAGGAGTCACCGTGACGGCACGGAT
GATATTAAGGGCAACCTGGCAGTTAAAGCAAGAGACTCTAGTCTACGGTAAGGCTTATCGTACAAGGGTCACAAGCAGACAAAAAGCCTGCAAGAGCGAA
CCCAGGGTATCGGAGCGATCGTGGTTGGTACTGCACCAACTATTTGGAAAACAACACACAAACCACTACAAACAGTGGTTGCAACATTACTCAAGTCGCA
CCAATTGGCAAAGTATACGAAAGAGATGCTCTGCCACGACAGCGTACCTACAACACTTCGGATCCGCAT