Description :
From Genome Similarity Track
Location :
Scaffold_325:16542- 23272
Transcript NameFunction/comments
Phyta_totarag7138glycosyltransferase

Sequence
6730 bases(100 bases per row)
TGGCCATCGGCTTCATCTCGGCCATCTCGCCTAGTGGCGGCCAGCAGTGGTTCGCCCAGTTTGAGTCCATGGGCGACGTGGTCGAGCCCTACAAACAGCA
GGACGTCAAGCTCACGTACGTGGGCATCGTGTTCGCTCTCTCGTCCATGGGATTCTGCAAAACTGTCCTGGAAGCGTGTCACGGCTGGCATTTGCTCGTT
GCTAGTGAGTCGTCCGAGACATCGTCGCGTTCGTTCAACTACGGTGgtgcgctggtgctgcgtaTGCTCTGGAACGGAGCGTTTGCGGGCATCTTCGGCT
TAATGATCTACACCCCGCTCATCACAAGCGAgaacacggagctgctggacaaggctGCGCCGGCATCGGTTGCCTACATTCTGCCGGGTGCGTTGATCAT
CGTCGTTCAAGCCTTTGCCCCGTCGATGATTACCAAGTCGTTCGCAGCCAAGTTCATCCGTGAGGGCGAATCCTGCTACGTTGGACGCAACATGGCGCCT
CCCATGAGCTACCAGATCAAGTACATCACCTTTTGGTTGGTGCTGTGGTCACTGAAGGCGTTCGTGTCGTACTTCATCCTGGTCCGTCCGCTGGTTCTTC
CATCGCTCGCCATCTACGAGATGGAACTCGAGTACGGTAGCAACGTGGTGTCGTTCCATAACTTCGGTGTGATTGCTGCGCTGTGGTTGCCAGtgatctt
catcttcaactaCGATACCCAGATTTACTTTACCATATTCCAAGCTTCGCTTGGAGGTATGCAAGGTCTTATCATGAAGACCGGTGAAATCCACGGCATC
AAGGAGATCACCAAGGCTTTCCGTGTGGCTCCTCAGCTCTTCGATCAAAAGGTGGTGACCAACCTCGCTCGCTCaaacgatgctgctgccgacggttctg
ctgctgcatatcAGTCGCAGATGATGCTGCGTTTCGTGGTCGTCTGGAATGAGATTGTGAACTCTTTCCGCGAGGGAGACCTGGTGGACGACAAAGAAGC
TGCCATCCTGCAATACGACATCCAGAGCTCTGGTGATGTGTTCGAGCCTGTGTTCCTTTCCGCTGGTAAACTGGTGGAAGCTCTTGACTACACGGTGAAG
CTTGGCAAGGAAGGCAAGGGCGACTCGCAGCTCCAGGTTTACATGGTACAGAAGGATTGTCTGTCGGCTGTGCGTAGCTTCTTCACGGCCAGCATGTACG
TGATGGAGGCTCTGCTGGGCAGCGACGATGCGGACATTCTTGATGCGCTTCGCCAAATGGAGACGATTGCTGCGAACGGTAGCTTTATGAGCACGTTTGA
CGCCAAGAGCCTGGTGCAGTTGCGCACTGTGTCGATGGAGTTCTTGGAGGCTGTGATGGATCTACCTGACCCGGATGCTCAGTCCTCGCATATGACCACG
TCTAGGGTGCATACCATGGGTGTTGTTCGCAActtcgtggccaagatggagAACCTGCTCAATGCCATCCGCATTTTCGCGAACCGCCCTGAGCTTGCTG
CCAAGTTCAGCAACTCCAAATTTTGCTCTAGCGCGAACGGCTACGTGTTTGCTGCGCGCGGTCTGGTGAACCTGTTCCACAACGACACAGCCATGGGTGC
TGCTACGCGCGCGTACCTGCTGATGTCACTGGAAAAAGCTGATGCTATGCCGCGCGTTCCTGAggctcagcgtcgtcttggtTTCTTCATGAAGTCGCTT
CTGATGGACATCCCGCAGCTGACGTCGGTGAAGGAGATGCACTCATTCTCTGTTGTGACACCGTTCTACAGTGAAAGTGTGTTGATTTCTCTGGCAGAGC
TGAATGACCCTCTAGTGAACCACCCCGTCTTCCAGAAAGTCGaggagaagggcaagaacaTTACCATTCTGAAATATCTGATCACCATACACCCTGAGGA
GTGGGAAAACTTCTTGGAGCGTATTGATGTGAGCACTGCcgaggaagcgcagcagaACTACCCGTTGGAAATTCGTCTGTGGGCCTCGTACCGCGGTCAG
ACGCTGGCGCGTACTGTTCAGGGTATGATGCTGTACGAGGATGCCATCAAGATCCTGCACTGGCTGGAGATTGGTTCAAGTCCTGGCAAGACTGCTGAGC
AGAagcaggcgcagctggaggacaTGGTGCGCTTGAAGTTTTCGTACATATGTGCTTGTCAAGTGTACGGTAAGCATCGCGCGGAGAATAAGCCTCAGGC
TGATGACATCGACTATCTTCTGAAGACGTACCCGAACTTGCGTGTGGCCTACGTGGACACCATTATGGTTGATGGAGGCAAACAGTTCGACACTGTGCTC
ATCAAGAGCGAAGGAAACGAGATTGCGGAAGTTTACCGTTACGAGCTGCCCGGTGATCCGATTCTTGGTGAAGGTAAGCCCGAAAACCAGAACAACGCGC
TTCCGTTCACGCGTGGCGAGTATCTCCAAACTATTGATatgaaccagcagcactactTTGAGGAGTGTCTGAAGATgccgcagcttctggtgACCGCTGA
CCTGCACCCTTCGAAGAAGCCGGTGTCGATTATTGGTATGCGTGAGCACATTTTTACGGGTAACgcttcgtcactgtcgaaGTTCAAGTCGTGGCAGGAA
CTGGTGTTCGTGACGCTGTCTCAGCGTGTGCTGGCTGACCCGCTGTACGTCCGTATGCACTACGGTCACCCCGATATTTTCGACAAGGTCATTGCGATGC
CTCGTGGCGGTGTGTCCAAGGCTAGTAAGGGCATTAACTTGTCTGAGGATGTGTTCGCCGGTTTCAACTCAACActtcgtggtggtgtggtgACGCACGT
AGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTCTTTCGCAGATTTCAATGTTCGAGGGTAAGCTGGCCAACGGTGCCGGTGAGACGTCTCTCGCT
CGCGAGGCTCACCGTATGGGCCAGTTTATGGATTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTTTGCTACGTGGATGACGATTG
TGACGACCttcgtgtacatgtactgcaagGTGTACCTGGCCCTGGctggtgtgcagcagcagattgtGTACGACATGAACTCGACTGCTGTGATCACTGA
CAATATTGCCAACAACTTCGACGAACGTGTATTTACGGACTTAAAGGCTGTGCTCAACACTCAGTTCTACATCCAAGCCGGGTTTTTCCTGATGCTTCCG
CTGATGTGTGTGTACTTCGGTGAAGGTGGTTTTGTGCGTGGTATGACGCGTTTCATCGATATGGTCATCACGCTTGGCCCTGCGTTCTTCGTGTTCCAAG
TCGGTACGACGATGCACTACTTCGACAACAACATTGTGCACGGTGGTGCCAAGTACCAGGCTACGGGTCGTGGTTTCAAGATTTCTCGTGAAACGTTGGT
ATTGCTGTACAAGGCGTACGCAAGTTCACACTACCGAAAAGCGTGGGAGCTGATGGGTTTGTGTCTAGTGTACTTGGTGTTCGGTAACTTCTACATTTGT
CAGACAGATGCGTCCGCCAACGATAACACTTTCGCGTCCGATTACTGTGACACTTCTCAGGCTTACGGTGTGCAGACGTTCTCGGTGTGGTTCATTTCCA
TCCTGTGGGTGGTTGGTCCATTCCTGTTCAACAGTGACGGTCTTGACTTAAAGAAAACGAAGGTGGATATTCAACAGTGGTGCTTATGGATGTTTGCTGA
GGAAGACTACAAGGACGATGATCCGGCAAACAAGGGTGGCTGGGTAGGCTGGTGGAAGGGTGATCTGGAACAGCTTCACGGCTCGAACATGATTTCGCGG
GTTACTGTCATCCTTCGCGAGTGTCGACACTTCCTACTGATGTTCTACGTGGCCACTCTAAAGACGTCCGATGTGATGTACGTCGCGTACTCGTTTGGTG
CAGCTGTTGCTACGGTCATGCTTCTGGGTGTATTCCACTGTATTGGCATGGGCATGCGGTCCATGAGCCCGGTCACTCGCGCGGTGCTCTACTTCGCCAC
CATGGCCATCTTGAACACGGCGTACTTCCTGGCCACTTATATTGTGATGGACTGGACCTTCAGCTACTCGATTTCGCTCTGGTTCGCGTATGTGGCTGCT
CTCTACGGCATTAACGAGTGCTTCCGCATGTGGAGTTTCCCGCACTCGTCAATCGCTGGCATTCCGGTGTTCCAGCAGCTACAGTTCATGttcgacttca
tcttctgcacGGGTATGATAATCCCGCTTGTAGTCATGTCGTGCATTCCGTTCTTAAACGTTATCCAGACGCGTATGATGTACAACGAAGGCTTCTCGAA
GGTCATGTCCGCGTCATCGCAGTACGCCTTCTCGCTGGCTGCCTTTATGGGCGTTTTGGGCGGTATTGGCGTTGGTTGGCTCTTCAACTTACTttcgacg
ctggagcagtcgGCCAGTTTTGCGAGTTACGTGGTGACATACGATGGCGTGCTCAGTGGCAATGTCGGCGACGGCACGACTACGTTCATGCTGTACGGCG
CGTGTGTGGTGGGTACGATCATCGCTGGTTTCTTGAACTACTTCCTCGGCCGTCGTCTGTCCATCGTTGCTGGTGGTCTCTTCAGCACGCTCGGTATGGT
GGCTGTGAGTGCCAACGATGACCTTCGTTCGACCTTGCTGATGCCTGGTATCGGCTTGCTCGGCGCATCATGCGGTATTCTACTGCCGTCTTTGGCCATC
TACATCTACGAGATCTCGACGAAAGAAATGCGGGGCAAGgccatcttgctgctgggcatggGCTTCGTTGCTGGTAGCTTGCTGGGCGGTGTTTTCGCGA
CCGTGAACCAGTTGGGATGGATCTGGCAAACGTTTGCAGCCTGCATTGTCATCGCGTTGGTCACTCCGGTGGTGAACGTGTTCCCGGAGAGTCCGTACTG
GGTGCTAGAGCGCAAGGGCTGGGACGCGTGCGAAGCCTGCCTGGTGATCTTGCGTCGCAAACCTGACGTGCAtgaggagctcaagatcaTGCGTGAGGAG
GAGACTGCTGACGAGGGTGGTGCGGGCGCCTTCAAGTTCTTAATCGGTCTGTTCCTGATGCTGGTGTCATCGCTGACCACGGGCTTCCTCAACGCCTTCG
TCAGCTACAAGGGAGCTAGTGAGTACACTGACCAGGACCAGTTGTTCGTGAACTCCATGGCATTGCAGATCTCGGGCGTCgtgatcgccttcttcttcat
cgacaaGTTGGACCACAAGTCCATTTTGTTCGGAACGCTCATTCCTGTGGCGATCTGCGCGGGTGTGCTGGGCTTCAACGAGACGTccgacttcctcggc
gaCTCGGAAGGTTCTGGCCTGTACATCAGCCTGGTCGTTATGCTcatgtacttcttcatggGACTGGGTACGAGCTCTGCGCCTTGGTCGGCCTGTGTCG
GCATGTTCACCACGCGTGGCCGCGCCTCGTCGACGACCATGTTGTTTGcaattttcttcttggcggacATGGGGTACGTCTACATGCACACGGACGACTC
CCTCATGGCGAaagagtacatgtatctgtACGCCATCGCAGGTTTCAGCGTCAttgcgctggtgctgctgttgggTGCGGGtaccaagaagaacggtgTC
ATCTGCACCAAGACTGAAGCTGAGCGGGACCGTGATCGCATCGCTCGCATGCGTGCCGAGCGCGCAAGTCGCAACACGCGGACTCCCGGTACTGCGCGCC
AGCGGAACCTCAGCCGTGTGCGATCCAAGTCCAACGCAGGCGGCCAGCGGGGCAACGCTACGCCTGGCGGCTACCAGATGTACGAAACACCCGCAAACGC
TGCGCCGCCGCTCATGCACGCACGCGCTTAGAGGGACTACCACACATAGCTCAAGCTATCTATCCTGTTATGGAGCCTCGTTTGTTTTGTACATACATTT
TTGCCTCAATACAGACTTTCGTGAAGTTCTACGTTGATTGGATTGTTATGTGCTACGAAGTTTCCGTAGATCTGGTCTGCTGTTGACTGCAGTGTTTGTA
GAGTCGCATCTAGCGCTCTGCATCGCGAGGACATCTCGAAGCAATCACGGCAGTTCTTCCTCGTTTCCCATCACAGTGTTAGACACGATCTCTGCCACTT
GACCTCAGAAGTCGGCAATCGTGGTCCGAGTCGGCACCGAAGATGTTCTCCTGGAGTCTGTAGATAGCGTTTGGTTGAATTCGACTTGCTCCCGTTGGCA
ATCGGCCTTGGTGTTAAGCTTACTCTTCAATACAGTAGCTCCTCCGCCGCAGCTGGAAgttgttcagcttctgccttGCTCTCATCACCTTTGACTGCGT
GACTTGAGTCGTTGTTCTCGATCTCGTTCGAACTGGAGCTCGGGCAGGTTTGACTCGCTCCAAGTCACTGAGAGAGTCACAGAGGCTGCCGGCAGCAGAC
TCGTGGTCGACTTCCTTTGTCTCTTTGGTTCCAGTCTCGCGGATTCAGACTTGGTAAAAAAACACATTGGCGAGTCTTTCACTGCAGCACTTCTCGTCGG
ACACAGTCGCCGTCGCACCAGGTCGCGATACTCTTGCGTCTGCTCCTCGGACACGTGAACATCGGCGAAGTATTCCGTCGGCAGTGGGAACGTCACTTCG
ATCGAGATCCGCGTACCCGACAATGATTCCTCCATTGACAAAAATCTCTCAATCGCACCGTAAAGTCgagagtgctgctgcaagtgcaacaGCTTCCAAC
GGAACGTAAGGACGATACTGTCCACGTTGT