Description :
From Genome Similarity Track
Location :
Scaffold_242:16541- 39750
Transcript NameFunction/comments
g14263.t1hypothetical protein
g14264.t1hypothetical protein
g14265.t1OWZ12061.1 TKL/DRK protein kinase [Phytophthora megakarya
g14266.t1RAW21529.1 hypothetical protein PC110_g22029 [Phytophthora cactorum

Sequence
23209 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAAACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCATCAGC
AACTTGAACCATCTGCAATCGTCGTTCGCTACGCCGGGTCCGCAGATAATCATAAAGTAGCCCGCCACATGACAAATTTGAGGCAGGTTCCCACGTGGGT
TCATCATACCCACTCCACTTCACTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGACTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCATCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCCAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTTCCGGGTTGGAACAGGGACCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCGTCGAC
ATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCAC
GAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGG
ATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTC
CCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTC
AGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTC
CGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTG
GAACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCT
GGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAAT
AGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGG
CACCACTAGACGCATCGCTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGCTCCAAGAAAATGCAGTACACCATCCTCGCTAAGCGCGAACTTG
TCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTCGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCT
GGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTACCTCGTTGCTCGATTGCTC
GGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGG
ACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTC
CACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTC
GACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGG
ACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTA
GGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTC
AGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTATCCA
CCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTGTAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAG
GAGGTGACCCCTTCGTCGGCGGTGTAACCGGGGCTAACGAGTCTTCCAATTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTGCAATC
GTGTTCCTTGACTCTGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTAGATTTGTGCACCCATTCG
AGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCG
GGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGTAACTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCA
CTCATTCGCGAATAACGTGACATGCGCCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGC
TTGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCATCCTTCAACTGATACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAAT
AATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTC
TGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGT
CGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCAT
CCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGT
CACCCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAG
AAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATAC
GAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGA
GCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCG
ATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTTCAGCAAGC
CTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCAC
ACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAACACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCG
CTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACT
CGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGCGGTAATCTCATGCATCATTGCTACGAAGGCAGA
GTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAG
TCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGTCGGTTCCTCAGTGC
CCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTAC
AGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCC
TCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAA
TCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTC
GTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATG
CTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGTACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTC
CGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACACGCTCCCAGCCTAGCGT
GACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAAC
CGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCA
ATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGAT
TTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGCCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCC
TTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTT
TGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAG
AGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCT
TAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTC
TCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCA
GCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACT
CCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGC
GTCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGT
CGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTC
CAGATTTTCGCTCCCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCG
GTCTTCACACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCTCGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGG
TTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACG
CATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCA
TTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTG
ATGTTTCCGAGTGGGAGATGCGTGGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAGCTCACGAATTTGGCGTGCCCATTCTCCCG
TCAAGTCACCCCCCGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCGTCGCGGAGGTCGTAACGTCGGCTGGGCGTCTGCCTTGCGCTTCGTCC
AGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGCCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATATGTC
GACGTCGCACCTTGGGCTGAAAATATTCCGGCCTCGGTCGACCCTCTGGGGCGTCTCCCAGGGGTCACTGGCAACGGAATCATGGACGGGTCGACCGGAT
CCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGATCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGC
GTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGC
CGAGTATTCCACGACTCCACGGGCACAGTTAACTCGCCACTGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGC
TCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGTCGAGAATTCGC
ATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGG
TTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTATCTTCCAGGTCATCTTCTT
CGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACC
GGAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTTTCT
TCTCTCGAATGCTCGTTAAGATCAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGCGTAGGAACAC
GCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAA
CGATCCCTTACACCGGGTTGGTTGCAAGCACCTCTGAATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAA
TGCAATATTGCACTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGGAAGGGTACTGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGT
AGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACCCTCGGCCACTCCTATCTCTTGAAATGACC
AGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACGAAGACG
GACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATAT
CTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTT
TTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACGC
TCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACAATAGGTAATGATCGATTTTGTCTCTTTC
GATAGTCTGAAACCCTTCTTAGTACCCCGAAGTGTGATACGGTCCCGTACAACTGTCTCAAAACCGTCTGGGTTAAGTACATCAACATTACGGCCACGCC
CCTGCTGGATACCCTTAGCACTGACTTTGACCTTGTGCCCCTCGTCCGGTAGGTAGCAGATATAGTTCTTAGAGGATAAAGAGACCATTGCATCACCTCG
CCACTCTACCTTGAATAACCCAGGTGTGTGGCGATCGAACTTGGCTACCCCGGCATTGTAGTCTCGCGGGAACCACTCATACTTATGCTCGTCGAAGTGA
TCACGTAGTTCAGGCTTGATGCATTCTTTGAATGGGTTATCGCAGCTGAACGCAATATAACCACTATCCGTGTCCATCTCCTGATATTGAAAGTCTGAAC
GATCAAAGTAAAAGTCGATGCAGTCATAGTAAAACTGAAGCATGCGTAGCTTAGCGAGCTGATAGATAGCAATCGATAAATGGATCGGGTTCTTGTTGTT
GAGGCGACGCTTTTTCATCGTAATCTCACAAAAATCATTAAGCTCCTACAACCCGTGGAACGTAAAGTGTTCGATCTTGTTCTTAATAGCTTTATCGTTC
GACTCATACTTGACCACTTTGTGCTTGCTCATATCCATTCCTGATCGATGTTGCCTACAAGTTTCATCATCTCAGCAATCATCGCCTTCGACTTATCAAC
ATCCCCCTCTCGTCGAGCGTTTGATACAGCCTCCATAAATGGAGCAAAAGCCTTGTGGGAGTTCGCTTTGATGAAGCTGTAAGTCTTAGCGATCTCCAAG
CCATGAGAGAGATACCACTTGAGCAAAGGTGCGTATATAAGAACTTTTTCACCAAAGTAGCTACCTATCAGCTTCCGAGCTGGTTTTGCTCGGCTTTGCT
TACGTGCCTCGTTGTATGTGTACATGTGATGGCCAATGACGCTATCATCAGCACAATCGATTAGCGTGTTTTTGAAAATTGGGGTCATCTCACTGAAGTA
CTCTTTCAAGTGCTCTGGTGTTTCAATATCACATTCAAGAAAGCCAAAGATCTTGTCGGCAACGATGTCCTCGACAATGCCGTCATAAGCCTCGATCGTA
GTCAATCGTCCGCATGACATCTCATTACCAAGTGCCCATAGGTAAAGAGCGTTAGCATCGTATCCGATAATTTTCTTACAGAGCTTGCTACCTCGAATCT
TCGTCTCATTGCGCTTAGCGTAGCGATTGAAGATAATAGATGGACCTCCAGCAATGTTGGCTTTCATCTTAGCGTAGATGTGTTTTTCCTCCTTATCAAT
ACTATACACCAATCTGTCCGAATTGAACTCAAGCAACTTCTTATAGCGGAATCCTTTGAGCGACATGTCCTTACGCGCGGTGTTGCACTTGATACAGCTG
ACCAATACGTTGCCATCGATGTGTCCAAGCTTGTTGTTAATACGATCTGCTGAAGCGGTATCGGCGGTCAGCTGGCAGTAGCATAACCCACACAGATACT
TTTGCTTTTGCATCAATGAATCCAAGTGATCAAGTGTCATACCGAATTCCCGCTTTGCCTTAGCATCCTGACTCTTGTAGCCACCCATACGCTGAGTTGG
AAATTGGAATGCGTTAGCATGTGCTTTATCCGGATATTGGAGATTGTTAAAGCAGGTCTGATACATAACTTTTTCACTAAGTCCTGGTAGAGACACACCA
TCAGCGAACATATCCAGATCGAAACGCATGAATAGCTCGCGCTGGGCTTTGATAGCCTTGATGAATGGGACTACATCGAGATTGTTGTACCAGACCAGTA
GGTCCTTGATGGATTTCATCTCATAGTACTTCCACACAAACTTCACTCGCTCGTATTCATCATCGCTGATGCTTGTTCCACGGAGCTTGCTGTCAAAAGC
TGACTTAGGCGGGATATTAGTCTGGTTGAGTACATTGAACGCAGTGATGTACTCATACGGGAAGAGACCCTTGCCAAGACCACAGACACATCTGATTTTG
TCATCACATTTGCAGCCACCGAGATATGTCGTAAGATACTTATCGTAGCTGGTACCAGCCGGTACATAGTTGCTAATATCGAGCATTTTCATGTTCGATG
TAGCAATGCACATGTAGCTGGGGTTCTTGATAACAGATCTGATGTTGTCAGTACCAATGATGGCGAATAAGTCGCTCTTAATCAAGTTGATATCGTATCG
ACCCGAATTGAAGCCGAACACTGGAACCTGATCAATCTGCTGTTTAAGACGCCCGTAGTCGGACCTCTGCTTACCAAAGCCAAGACTGTTATGGAAGTGG
AAGAAGGTATCATACTTCCCTTCCTTAATCCAACCCTCCACATCAGACATCTTGTACTTCTTACCCAGATTGACGCCTGGAATTTCCAAACCTGTCAGAC
CGTGGGCATTGATAATTTTTTGCAGAAGCGACTTATACTTATCGACATTGTACTGTTGGATCTTCAGCGATACATCACCGATGTATTTGAACATATCTGT
CAGCAGCATCTTCGGATCGTTATTCACAAAGCAGCGCACCTCCTCGGTTAAGCTATCAGCTACGGATACAGACACAGGAATGTGTTCGTTCGTGAAGACA
GTACTTTCACCGTGTTGAGTGGCGGTAGGCTTAAGGATTGCCTCAAAGTCGTAAACAATGAAGTGGTCGATGTACTGGTTGGCATCGTTAATGGAGTACT
TTGTAAGCAGTGATCGAATCGTGTTAGGAGCTGGCTTGTAGATAGTTGGCTCAGCAGGGAAGCTCTCAATATTCACAAGCTCGCACTGATTTTTCTTGTG
GTTTTTGAGTCTTTCACCGCTCACGAATATCATTTCACACTTGGGGCACTGATACTTAGACTGAAGCATATCGATGCTCTTGATGTAGAGAGCATGATTC
TCGTGTGATAGAATATCCATAGCTTCAAACCCCTTGTCCGACCTACGAATACATTCTACATTCCCAGAAGCTACATCCATGCTATATACGTTAATACCGA
GCTGGAAGCAGTCCTCAACCTCATCGAGCTGTAGCAGGTCAATAGGCTTGAAGCTTCTAAATAGACTCAACGTATACTTTACTCCCTTAAAAGAGCAGTA
GCGCTTGAATGCATCCTTCACCTGAGTCTGAATTCTGCGAGGATCCTTCTTAGCGCTCTGGAATGTGTGCCATGCGATACAGTGGAAGACGCACTTGTTG
TTGGTCTTAGGGAAGTTGATTACATGCTTGTTTTCGCGGATAATCTTAGGAATAACAGCGTCGCTATCACCAAGATCATGGTCGCGATGGTAGACAAAAA
TCTTGAATGCAGTGATCGCCTTAAGCTTATATCCGGAGCTGGGATAGTTCAGCTTGTCAGCCAACTCCATCGACCGGATTTCTGAAATCACCTTCTTTCG
AATATCCGCCTTGCTATTGATTGCAACGGCGTTATTGAATACATAAGTGTTAGCGAGATTCGGGTAGAAGTAGCGAGTGTCATCAGGATCAGTCTTGCTC
ACAAGTTCGTACCCAAGAGCAATATTTACCTTAAAAGCACTTGTCTGAGTCGAAAGAATGTTCTCGAGCTTATCGTAGAAATCAGTAGCCTCGACACCCT
CATATAGGTGTGATTCCATGTGATTACCAGTGTAAAACCGGTACTTGGGATCAGACTTATAGTCAGGCGGCATATGCTTCTCAAGGGTTTCAACAGAAAC
ATTGTACTGCTTAGCCACCAACTTCTTGTTGGCTGAACGAGAAATGTTGCTAACATATACCATCTTTCCAGTTCTACCTCGAACCTTAACCCGGTAGCTG
CTACCCCATTTGACAGCTTGGATATTTAATCTCTTTAATCCTGCGAGTTCGTATGCAAACATACTGCCTGTATATCTTCGACTAAATTAATCTCGTGAGA
ATCGACTTTATAATTATTGGACCTTGTATCAGGATCGACTTTATATTGGGGCTGACTTTATATCTGAGGAAAAAAAATTAATTAATTAGTTAAGTTCGCT
TTGCTTAAGTTCGGATTTGCTTAAGTAATTCTTCTTCTTACGAGCACGAATATCTTCGCGATTCTTCTCATCATATTCTCGCTGCTTCGCCAGTCGCGTT
TCCCTTGTTTTTAGATAGTACCGCTTTTGAGCGGCTTTGATTCGCTCTTTGTTAAGCTCGTATTGCTCAGGTGAGTATGTCATCGTTATATATTATCAAC
TTTATATTTATCAGGATGGAAAAATAAATATCTTGGTAATTGAGAAGTTGAAGATACCATGCTTCCATTAAATTATTAATTTCCTCTTTCCTCTTCCTCT
GTTTCTCTTTGTGCTCTGTGAGGGTTGTTGTTGTTGAGGGTTGTCGCTGAGCTTCAGTAGCAGGAAGCAGCGAAGTGTGCTCGGTCAATTCTTGATGCTG
CGCTTCAGAAGCAAAAGTCAGGTCGGTCATTTCTTGTCGCTGGGCTTGTAACGGTGTCTCGTCCTTCGCTTCCTCGATCATGTTGTCAAGCTTCGATTTC
CAATGTTGCGAATATGACAGAATCGCCCCCACCGCAATGTCAACACCAATCATCTAACATACGATAAGCGAGCGGCCAGGAACTGTTAAACATCCTTTTT
CGTCGGTTGGATTCTCTCCGAGGGCCAAACAATGATTGTAATGACCACCAATATGACAGGTACGAAGCATTGAGCGTTGATGATCCACCGTCTGTATCCT
GCTCTACACAAGAAAATTAGTAACAACATATTCAAACAATTAGGGGCGAGGGAATACGTACGCTTATATTTCAGCGCTCTGGAAGCAGTTCCACCAATGT
CAACGCGAACATGTCCAGGAACCACCACCAGCACGTGAACTTGGCCTTCACCCGGTTGAAAATTATCGCCAAAGTGCTTGGGGTTCTTGATCCACAGTGT
GGGATCCATCTGCACGAAGCCTTGCGGGTGTCCACGTTCATCGAGCGCCACAGCTGCCGCGCCAGCCCCATCGAGCCACGCGCTGCCCTCCATCTTCGCC
AGGAAGACCTGCAGATCTTTGGCGTCACACGTGATAGTCGCCGGGTTCTCTCCCTTGATCACCTTCTTCAAGTCATACACCGAGTCACTCTCGTCCACAC
GCACCGAGAAGGCGCTTCCCGCCACACCAACGATCGCACAGAAGAGCTTCACCATCTTTCCTCGAGGCAGCAGATTCTGGAATGAGGAAGAAGGGAGGAA
GAGAATTTCCGGCGTACTTAACCGGAAAAGAAGGCGTGTCACATTCATGTAGACTTCCAAAAAAAATGATGAAACGCGCTACTCTGAAGTATTCCTTTTT
TGCGGTAAGAATCTGCCGGGGCGTTCTGTTCTATTGCTTTTATCAATGTCTAGCTTGAATGTTTTATATTTGTCAGGATGAAAAAAATCATGAAAAAAAG
CAATTTATTAGTGATGCATGCCGAAGGGAGAATCAGCTGAAATAACTCAACGTGGGAATAGATCGAGTGATCTGCTCAGCCACAGCACGCGCCATGTCCC
AGTCGGGACCTAACATACTGGCGATGTCATAGTATCGTTCGATGCTCTCACGAATCCCGCCACTTTCACCCTCTCCGATAGAGGCCAGGAACTCATCAAT
CTTCGGCCTCTTGATAGGTTCTTGGAAGCACGGAAGGCTGACCACTGCATCAGCACCACTTGCCAGTAGAGTCTCAATCACCGCAAACGCCTTGCTTGGA
TCACAAATAGTCACCGATTCGATGGTACCGCGATTGTTAGTCGGGTCGGCGACCCAAAAAAACTGCCAATACTTCTGCAAGTCGGTCAAGAGTGCCATCC
CAGGTTCAGCAGCCTTAATATCCAGTGCTATCAGTTCTGACACGGCCTGAGAGACGGAGCGTCGCTCCACCTTTTGCTTCACCTCGATAATCAATCTCAC
GTCAGGCAGCATTTCCAATTCGAGCCGGTTCTCCAATATCTGATCACTCAGTATGATCATGTCTGTGCATCCAGCAAATTTAATGTCGTGCCCTGGTACG
TCAGCCGAAAGAATGTCCTTCCCGCCTTCCCCTTTCTCCACACCGTACACGCAAAGCTTGTTCTTCGCGAGCGCATCACCAATGTTGACTTCAACGTACT
CGCGATATCGTTCACGTTGCTGTTCCTCGGTGAGCTTGATTTTCTGACCACTCTCATCGACTGTGTATCCCCACGTGAACGGTTCAACATGCTTCTCAGT
CTCGAATGGAACCGCGCGGGTAGCTCGCAACCGAACATGCAATTCGTCCAAAAGACTCGAACTCGCGCTCGAGTGGCAAACCTTCCGCTTTCCCAGCATA
CTTTTGTCCAGTTTGTCGTTCATTTTGTCGACCTTTTCCCTGAGTTGATCCATCTTGGATGCCTCACTCACTGAACCTCCAGCCCCCTCCGTTAACACCA
CCAGCACGTGGATTTGTCGCGACAGTGGGGTGGGCAGGTGGTTTTCTTCCAGCACGTCCTTCAGCGAATCCTCTGCCTGTAGCTCTAGGTCCTCCTCCAT
TAGCGCTTCGATGAGAGCCGTTTTCTCGCCCTTCTTCAGCTTCTTCACATCTTCTGTGAGGCTCGACAGCCACGCGCCGCCCTCCGTCTTCGCCAGGAAG
ACCTGCAGATCTTTGGCGTCACACGTGATAGTCGCCGGGTTCTCTCCCTTGATCACCTTCTTCAAGTCATACACCGAGTCACTCTCGTCCACACGCACCG
AGAAGGCGCTTCCCGCCACACCAACGATCGCACAGAAGAGCTTCACCATCTTTCCTCGAGGCAGCAGATTCTGGAATGAGGAAGAAGGGAGGAAGAGAAT
TTCCGGCGTACTTAACCGGAAAAGAAGGCGTGTCACATTCATGTAGACTTCCAACAAAAAATGATGAAACGCGCTACTCTGAAGTATTCCTTTTTTGCGG
TAAGAATCTACCGGGGCGTTCTGTTCTATTGCTTTTATCAAAATATAGCTCGGTCGAGCGGTTCTAAAACTACCCTAAGATCCAAAAGACGTTGCTTGTG
ATGGAGAGGTTGTCTCGTCAAAATAGCAGCTGGTCCGAAACAAGGTTCCAGGAATGTTCTTGGTGGTAAATTACGGTAAGGAAAAAAACTGCCGGCGTTA
ATACGGCCAAACTCGAGTCGGTGTCAATAGACTTGCAGGAATTTTTGCCCCGTGTGGCAATAGTTTACAGGTACGTAACTATTGCCACACTCTACCTACG
TACGCCACACCATCCAGCTGTTGACGTGTCAATAGACGATGTCGAATTTTTGCCCACTTTCGGATTTTGCTGCTGTTTAATTGGCTCGGAAATTCGAAAG
TGGGCAATTCACACTCCAGTGGAGGATAAGTTGCCCACTGCCCAACATTTTTTTTTGCTATATTAATTGGCTCGGAAATTTCGAAGTGGGCAACTTATCC
TATAGCATAGGATAAGTTGCCCACTTTGCGACTTTCCGAGCCAGTTAAACAGCAGCGTCGAGGATCGGACTTTCCGAGCCATTATTATTTCAGCAACGTG
GAGGATCGGAGGTCGACTCGACATAATTTATCTTTATTATAAGCTTTGGAGAGGCTGTGAATGGGGAGAGAATTACCCAGCTGCATCAAAGCACGGGACA
CGCCCGCAGCACGATCGACGCCATCGTCTATGCCAAGCCCAATCAAGACGAGTCCAAGTCCGGTAAACCCTATCGGTGGACCCCCATGCGTTTCGTGGTG
GAAATGCTGACACGAGGTCTTAAGCATCACAAACAAACCCAATCGCTCAAGGACATCGCAAGGATAATGGGGGTCGACCGTCGAGTATTTGGCCGCATGG
AGCAGGACATATTGGGTAGACTACAAACTGCAGTTGTAGACTACTGGTTTTCTCGCGACCAAGCTGCACCTCAGAAGCTCATTGATTTGCTCGACGGCGC
AGAGACCTCAGTAGATATCGCTATGTTCATCTTGTCGCATCCTGAACTGACCGACGCTATCATCCGGGCCTCCCAGCGTGTCACGGTTCGTGTTCTCGTT
GATCGGGCACAAGTCACCGAGAAAAGCTCAGCAATGATAAAAAAAACTGGTTGAAAACGGGGTCAACGTATATCACGCAGGCCCCAGACTCATGCACTGG
AAGGTAGCGATTATCGATGGAACCGTGTTGACGATGGGAAGCTGCAATTGGAGTGTGGGGGGAATGACGTTGAATTGGGAACATACTGTTGTATTGCGTG
GTCCTATTGTTGGAGCACACGCCGTTGAGTTTGACGAACACATGTGGTCTGTTGCCGTGCAAAACAACTGGCAAGTTGAGATAGATAGCCGCGGTAATGT
TCATCTGTAGCGTCAAGCGATGGTGACAGCAGTGCCGCAGCGGGTACTCCGAGCTGGCAGTTTGGTTTACAAGGCACGGGCAACTACAGCACGGTCGCGT
TCGATGGAGCCCGCCATGCAGAGACGTTTGAGACGCGCACGGCTCAGGCGCACCTTGATTCGATCAAACGTGAGTTCGAGCTGCTCTGGGATGAAGGACG
GATTTGGGTTCTTCTGATCGTAAGTGCGCCCGCTGACAGAGTCTCTTTCTGGCACAGTCTCTTGATAGCTAACACGACGGACTTGTGCGTGCTTCTCTAC
GTTTATTGCTTGCGTGAACAGTGTAACCTCGTGAGCACTAGCTTGCAACTTGCGGTAGACGCGTATCTCTCTCTTGGTGTCGGCGGTAAGAACTTGGGCT
CGACGTACATGCTTCAAGAACTAAACGTGACTGTTGTGCAGGCAAAACGCGCGAGTGCGATAGCATGTTCTTCGATGACAACGGCGGGCTGTTCGAGCAG
TCACTGCGTCTGGTGATTTCCACTGGGACGTACTTGGTGCCGAACTGGGGCGCACTGTATGTGTTTTACGTGCTGCCACGCTTCCAGTTCTCCACGGTCT
TGGACGTGCCCGGACTCCTGATGGACGACGAGTGCGACGAGGCGGCGTATGAATTGCTTTCCGGTGATGAACGCGTAAAAACCAATGTTCTAAGTATTAC
TACTAGCCTCGAAGTTCGGCGAAGCGGACCACGGAGACGGAGACGCTCTCGAACAACGGCGGAACGATGATGAGCAAGTTATGGGACGACGAAGCTATCA
TCGCTGCAAGAATCCCCAAAGAGAAAGTCCTCGTTGGGCGTCTTATCAACAGAGGAGGATTCGGTGAGGTGTATGCTGGCACGTACAACGGACAACCTGT
CGCTGTCAAGATGCTGCTGCCAGAGCGAAAGAAGAACCTCACACAGGTCAACGCCTTCCTCTCTGAGGTGAAGCTCATGACCACGCTTGAACACCCGCAT
ATCGTTCAGTTTGTTGGCGTTGCGGTGGTGGTGTTAGTCGGCCGTCTATTTGATGTTAATGTTTGTTTTCTATAGACGCCTTTAGGCAGTTCTAAAAGAT
CTGCCTGTCTTCCTCGAAGATTTTTTCACTTCGGTCTTTCCTTCGGTCTTGCATGTGGTGGGTGTTCCATATCCGTTACAGCGGATCCTCTCTGAGGTCT
TGTTCGGTCGATATGGGTCTTCACGCCAAGGCGAGTATTTCAGGCTCTTGCATGGTAAGCCTCCGTATCCGCTAGGAAGGGTTAACCCTCTCGGGCACAG
CTGCGGTCCCATCGGTCTTCACGTGTAGAGTAACCAGCTCTTAACTCCGTGTGGCTCCGTTTCCGCTATATTTGGGCTTTGCTGAAGTCCTTCTGCTGTC
AATAAGCGGGCCGTCATGTCAAGAGGTTCGTATATGGACTGCTGTGTTGCACTCTGGGGAGGGGAAATCGTGAGCATAGAGGGGTCCCATCTCCTCTGTG
CTTGGTGCTTGAACGAGAACGCGAGGGGCTCACCAGGCCCGAGGCGTCTTGGTGTGTGAGATCTTGAACACGTGGGGGGTCACCGGGCCCTCCGTGCTTT
GGTGTTTGGGTTGCGTAAGCGCGATGGTTCACCATGTCATCGCGCCGTGGTACGTGCTTGTTTGGAGCGCTCCGAGGGTTACCAGGTCCTCGGTGCGCCT
TGGCGATTTAATTTTTCTTCTTGGGCAGTACGGGGCCGCCATGTCCGGTGCGTCTTGGTGTGGGTCTTGGACACACGTGGAGGTCACCAGGTCCACATGC
TGCGGCGATGTTGATATCAGTCTTGGTGGCAGACACCAGGCACGGCGCCGCGTCCGTGCCCGGCGTACAGGAACACCCCATCTCCCATTCCCAGCCCCAC
GTTGGGGGGACTTCGTCCGAGAAGCGAGATCTTCCGAAGAGGCGCTGGAGGTATTCTTGAAACCACTTGTGCCAGAGGGCGCGAAAAGCGAAGTGTTTGT
TGGCGTTGCGTGGGATTCACTCACCGACTTGTGTGTCGTTACCGAGTTCATGACCACCGATCTGAAAGCTTTGCTGTCCCAGTACGAGGAGCAGAATCTG
CCCGTCGGATTCGACCATGACAAGGTGAAGGTAGCACTTCACGTGGCCCACGCGCTCACGTACTTGCACTCGTGTGCTCCTCCCGTGATCCACCGCGATC
TCAAGTCGAGCAACATCTTACTCAACCAGGCTATGGATGCCAAGGTGACGGACTTTGGTATCTCTCGCGAACGCATCGATGCAACGATGACTGCTGGCGT
TGGTACGTCGCTGTGGATGGCACCGGAGGTGATGCTGGGCGAGCGCTACGACGACAAGGCAGACATGTTTTCGTTCGGCGTGGTGCTGTCTGAATTGGAC
CAGCACACAACGCCGTACGCTTTCGCGAAGAATAACTCTCGCTCCGGTCAAAAGCTGCCTGATGCTGCTATCCTTCAAATGGTGGCCATGGGCAAACTCC
GCGTCCAGTTCTCGGGTTTCGGTCCTTCGTCAATGGTGGAGCTGGGCTTTGCGTGTGTGTCTGTGGACCCGAAGCAGCGACCGACGGCGGCGGAAGCGCT
GTATCGACTACAGAAAATCTTGGCTAACGAGTTGTAGGAACACAGAAAAATACGTCCACAAGTCTTAAGCTTATGACTGTGCTGCTCTGACCAACAATCT
CTGCTTTGACTCAAGATGATTTCAGCGATCTGTTGCATCGACTGCTCTCTCTGGCAAACTTTCTTCCGCCGCATCTGTCAAGTCGCTGACACGCTGTTCG
TGAGGCTCCATTGTAATCTGCTAGAGCCGTGGGTGTCTCTTCGGGAACGGCTAACAGGGTCACGGGTAGAGGAAGGGAAACACTGCAAGTTGAGGTCACA
CGTCGAGTGTTCCTGGCTTGTCGTAGGTCGCTGGTTGCAGCATACTGTACCCATTATTCGCATCGAAAACGTTTTCCCGCAAGCAGCTACAGTAGTACCC
ACGTTCTCTTCAACGAGTCTTGGCTCCATTCGTTGGACGGTCATCAACCGACCCCAACCGACTCTACTCGTCATTCTCGATTTCTCCTCTTGGTCATGCA
GTCAGTGAATTATTTCTCGGATGCGTCCTGCTCCTCTCCAGTTTACTTGGAGGCCACCGCGACGTCGAGCTGCGTCTCAGCGGACTGCACCGCCACGACG
ACGACCTCGGGGGACTACTACACCACGATGACGTGTCCGTCGGATGGACTTACAGGCGCTTCGGACGTATTCGGCACCACGGCCTACCTGGTGGACGACA
TGTACATCGAGACGGACTGCGTGACCCCCTACTACCTACTCGCCTACGTGGCCTCGGGGGAGTGTCAGTCGTCTGGCAGTGGGAGTGCTGCAATCGCCAC
ACTCTTCTCCAATGGATCGGCCCAGCTCGAGCTGTACGTGGACTCGACGTGTTCGACCGCTACCTCCACCACTTCCATTACCGACCTAACGGGCACCACG
TGAACAAATACTACTCCAACTATGTCGGGTCGTCAACAAGTGGTGCATCTAGCGGCTCGACGGCAAGTAGTACAACAAGCGGATCAACTGTGAGTGCAGG
CAGCACGACGACTACCAGTAACACGTTCTTGGACTCCAGTGGCACGACGACAACCGACGGAAGCGGCTCGTCGAGCTCGTCCAGTGTGAGCGTCGGCCTC
ATTGCGGGGATCGCTGGCGGGTGTATCATTCTCCTGTTGATTGCCATCGGATGTTGCTGCTGCTGGCGGAGACGCCGCAAGAACACGCAGCAGCAGAATG
TGCACGTGAACATTCCGAGTCCCGTGGCTTATGAGCAAATCGTGACTCCAGTCACTCAGTTCCGCGACAAGCCTCAGTAGTAATACTTCGAACATTACGC
CGGCAGTTTTTTTCCTTACCGTAATTTATCAGCAAGAACATTCCTGGAACCTTCTTTCGGGCCAGGATCGCATTCAGCGACACGACCTCTCGACCACCTA
AGAGCGAAACCAACGCCCTTTCGCTCTGAAGGTGGTTTCAGATCATCTCGAGCACTGGGGACAGTCGATGAACTCGTTGTTGACGACGGGCCACTTGTTG
TGGACCATATAAGGTGGGCACGCGTCCAGTCTTGACAGGGATCCCCGCGCCCTTGAATTTGCGTACCCAAGCCATGTTTTTGGTCTGGAGCGCGCTTCGC
TCGTCGACAATCATGCGAACGACGCAGCCGGCTTCAACCGCCTTCAGTATGGCCTCCCCGATGCGATCGTTCGTAATGGACATGTTGCAGATGTCCAGCG
AACCCCGTGGTCTAGCGGCCAGGCCAAGATAGTACACGATCTTGTCCTCGGCGTCGGCGTCTCGAGAAAACCACCGCACTGGCGAGACGTTTCGTGCAGG
GCGCGTGTCCAGCATTCCGACTTTCCCATACTATCCCGGATAAAATCAAAATTATCCAGATACACACTTTCCTGTGAGACTTGATGAGGTCAACAAATTC
AGAGCGAAAAGTTTGCCAAACCTGTAAAACCATATGCCAAGCAAATATCCATTTCCACAGGTTTGCAAACAATCGCTCTCAATTTGTCGATTTCACTATA
CTTTGTTCAAGTGATTCTGAAAACGAATTTTCGTTCCGCTCTGAATTTGTCGACCCCATCCAATATCGAAGTCTACCTCGTTAAATGAATAGAATATTAC
ATTCTGGCAGAGGGCCTCTAGAAAACCATAGTGTTGCAGAATGAGAGCGGGCGCGAAACCGCTCTGAATTTGAAACAGAGGCCTATTTTTCTGGATATTT
AATGGATCTAGCTAGCATCGCCAATTTCTGGAACTTACCGTCTCACATGTACGACGACGCAGAGTGATAGTTAGGACGCAGAGTTCATTTGCTACACCAC
CAACTGATAACATGACTTTCGAATTAACTTTTGGAAAATACAAGGGCACGCCCATCGAAGAAGTATATTCTTCCGACCCTGGCTATTGTCGATGGATGCA
CAACCAACCCAGTCTCAATATTACTGAGGATATCAAGATTTTCCTTCACTCCAAGTTTCTAAGCAATGATAATTCGTATATGATGAGTTGGGGCAAGTAC
AAGGGGAAGACGCTAAAGCAAATTAGTCGCACCGATTCTAATTATATCGATTGGCTTCATAAGAACCCATTTGTAATTGAAAAATGCCCTAAGCTTGTAG
AGGCTTTAGAGCTTAATAAAAAAATATCTTTTTTTTTAAATCCAAAACTAAGCAGTGGTAAAATCAAGTACCTCACCCGCTAGACGATCGTAGGAGAGCT
CTTGTTCACTCACAACCAACACAAGCATGTTGGTGCCCTGGCATCCTGCGTTAACACCGCTTACCTGAACAGCCTGGGGTACATCGTGTTCCGTCAGGCG
GCTAACATC