Description :
From Genome Similarity Track
Location :
Scaffold_1303:1654- 2975
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1303-fgenesh-gene-0.0Haustorium-specific membrane protein

Sequence
1321 bases(100 bases per row)
CACCTCGTAcACCttttGGCCACCCGACAGCACATTCACACGGACATCGAGGTCATCaacGCTCTTGAACGTCAACTTCAACTgaCCGTCGCCCGCCTTC
TTCCACTCACCCGTCGAGTTACGGAACGCCTTCTCCATCGACTCCAGACCAACGGCCTTGTCGGCCGGACCGTCGTCGATCTGACCCACGTACACCGTTG
GtCCACAGATTGGCTGCACGAACTCACGAGCCATCGCAGCGATACCCGTAGGATCGAAGATGGAGATCGCGTTCAAGCCCATGTCCGCAATCGTGAGAGC
GTAATCAGCAAGCGAGACCGTCTGGCCGTTCTGGCTCGCCGACGCAATAATCTTATCAATGATAACGTGCATGGTCTTGATAATCTCGTCACGGGTCTGG
AAGCCGTCCGGAGCGTTCTCGTCCcAGCAACCCACAGTCGCCGCAGGCAGATCCTTCAGCACGAGCTCCGAGCCCTTGATGGCAAACTGGATGTAACctA
CTGGGTCCGTTGGCTTCTCCTTGATGATGTTCTGCACAGCAGCCACGATCTTGTCGATCACCGACTTGAGCTCCAGACCGCACGTCTTTCCAGACTCCAC
GAGCTGCTTCAGCGTCGCCTGGTCCTCCGCCGACAACGTCGACACGGCGAACGAGTTGGAGGctGGTGGCGCCGTCGTCGTCGTcGTTGGCGTcTCCGTG
ATGGCGTGCTGGATCGTCGACGTGAAGTTGAGGAACGTGTTGAAGTCCAaCAAGTTCGTGCCGCTCGACTTGCTGTCGATGATCcTGCTGATGATCACCT
TGACAACATCCACGACCTCCTTCGCCTGGTCAAGGCCCTTTGGCACTGGGACACCAATGCACGTAGCAACGGCCGCTGGCAGATCGTACACCaCAAAGTC
CGACTTGTTCAGCACGTACGTGAGCTGCTCCTTGGTCGTGTCGACCTGGGCACCCTTCTCGACCTCGTCGATGTAGCCAACGATCTTGTTCACCGCGTTA
AACAGCGACTGACCGCACATGACACCGATCTGGACTCCCTTGGCTGCCTTGGTGATCTCACCGAAAaTACCAGATGTGGCGACGTTGATGGCGACGTTGG
CCACCGACATGACCTTCGTGAGCACTTCCTTGCCACAGTCCTtGTTCTGCGGGATGCACTCCATGCCACACTCCACTGGGTACTCAATTGGACATTGGGT
CCAGCACGTGGCGATGTTGTCGAAGTTGTAACCGGCACCGCACTTCTTGTTCTTGgCGATGTACGTCTTGCGGTAGCACGCCGTGTCGGTCGGCTTGCCc
TTAATCGGGCcGACCCAGTTC