Description :
From Genome Similarity Track
Location :
contig_86:165347- 166605
Transcript NameFunction/comments
g10494.t1hypothetical protein

Sequence
1258 bases(100 bases per row)
GGGCAACGATAATCCTCCGGCAACAGCGACCGCTGCAGTTTGTTGAAAGCAAACTGGCGCTTGCCCGTGTTCTTGAGCGCGTTCTCGATACGCACACCGT
GGCTACGCATTACAGAAACCGTGGCAGGAACGCGGTGTTCCGGCAGGTCGTGATGGCGCTGCAAGATACGTACCTGCTCTAATGTCACAGACATAGCTGT
ACGATCCTTGGCACTCTTGCACACCGTGACACGTCCACCACCAAGCTCCCGACATAGGTCGGAAGACCGCTTCAAAATCTCAGTGCGCTTCGTCTTGACC
AGACTCTGCGCAGCTTCGTTGATACATGCTTCAAGACCGCGCAGCTCCTGTGTTACTTCATCTTCGTGAGATGCAGAGGTGATGCGATTGTTGAGTCCGT
TGACATGGCCTTGTAGCGCTGCGAGCCGGTACGACCACGGCTGGAGGATGATAAACCACTCAAGCCGCTGGCAGGCATAGCTACCACAAGTCGACGGTAC
TTCTCGCAAAACGTCTTCAGAGGCTTTAGACTGCGGAAGTTGATGATATCCTGCAGCTCCGTCTTCGCACGTTCCGTGTTATTGGCAATCGTCTGCATTT
CATTGATACCCTGCGAGAACAGCACAGGCGTCACATGAATCTCACCGCCAGCAGCCAGCCGCTCGGGCAGCTCCACTTCGCTGGTGGCGACTTGCACTGT
CACGATGTACTTGATGTGAGATCGCTTCGCACCCGTCTTGTTCGAGACAGTGACCTTCACAACGCCGGCCTCGTCAGCCACATCTTTGCGGCGTGACATG
CGGAACGAGAAACGGTTCATGGGCTTATCACGAACATCTTGAATCACAAACGCCACACAGCTCAAATGTTCCACCGAGCCCGCCATGTCTTCCAACATGC
CGATTTCCTTGCCGTGTGTGGACAACAGTGACTCAACCTGGAAAAGGAAACCCAGGAACTGGCGCAGCATATCTTCGCCACGAACGACGTCCGGGTTCTG
AATTGCAACCTCCACTTTTCGCACGAAGCTACATGTGAGCGACGCCATCGCTTGGGCAAACGCGCAGTCCATACGCAGCTGCAAGTCCCACTTGAGATCG
TCGTATTCACGAACTTCCTCAGGCCACTTAGACAGGTCAAGGTCGGCTTCTGCGATCTTGGCCTCCATTTTTTTGCGTCTGTTCTGGTAGGACAGAATGC
CGCCCTTATTGAATTTGATACGTGTGCTGCTGGTGCGCCAACAGTCGTGAAGTCGTAC