Description :
From Genome Similarity Track
Location :
Scaffold_64:165335- 167793
Transcript NameFunction/comments
Phyci_230401conserved hypothetical protein
Phyci_313903Hypothetical protein

Sequence
2458 bases(100 bases per row)
TCCTCGCCTGCCATTGCCAACACACCTTGAGGTCGAACGACGTCTTGGTGAAGTGGCACGTGACGTTCTCCTTGGGTAGATTGCCCACGCCGTCGACGCC
CGACATGATGTAGACCGCCACCTTGGGCTTGCCGTAGCCGTCGTCCTCCCACCCGAAGCGGCTGATCTCCGAGAACGTCGCCACGTTGCTGGGCTTGGGC
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCCGAGGTGTTCGATCTGTATACGGAGCGAGCGAGA
CGTCAAGGCGGAGTTCAGGTGCAAAGAAGAAGGCTGCACTCTACTGGACCAATCGCTGTGCTCGTCTTGCTGGAAGAACACACACCAGTCGAAAGACGGG
AAGGAGCACAAGCAGCTCCCAGCGTCGAGTGAGTTTTCTGCGGTGGATGGGGATGGAGGAATTGTGTTGTTAATATTTGTGTGTGTGTGGCAGTTTGTCC
GCAGTGCCAACTGGAGCGCATCGCGTACTGGTGCGCAGAGTGCGACCTGAAGTTTTGCAGAGTCTGCTTTGACCAGATTCACAGCGTGGCCAAGGCCAAA
CAACACCGCAAGCTCGCCACGGAAGGTTCGTGCATGGCATGTTCGATGTCGCTGTACTTTGAATTGTCAAATCGTTTGAAAAACTCAACCCACCCTGTAC
GCTACCTCACAGGTGCACCCGGAACCTGCTTGGCAAAATCGGACTGGTCGGCACCTTTTCAGAATGCGATCATGCAGCTAATTACCGCGCGAAAGCATCC
AGCTTCAGGTCCCGCTACTTCTGAAAGAGATTCTACTGGTCCCAAGCGGAAGCGTGAGGTGGAGGTGATCGTTATAgacgacgacgacgacgatgacgac
gaTATGGATGGTGGAATGGCTAGTTCCTCGTCTGCTGCCAATGGAACTCCAGAGGTGCCTGTGGATAGCAGTGACGCTGCGATGAATAGGCAGAACGGCA
ATGTCAGAAATGGGGTTATTCGCCCCAGTGATGTGTTTGCACAACTAAACGTGCCGGTGCGAATTGCTCCCGCTCAGTCCCCAGTTGCTGAGCACTCGAC
GATTGAGCCCATTCCGTTCCCGCAAGAGCTAACAGGAACAGCACCTTCACCTTCTGTCCAACCCAGCTTGCCGTACAGCTCATCGTCGATGCTGAACGGG
ACCCACACAGCAAACATTAGCTCCAGTGTGGACAGTATGCAGTGGAACAACAGTGTACCTCAGTTCGCCGCTTCAGCAGGACGTCCAGCCGCAAGTACGG
GCTACGGAGCAAGTGCCACCAGCAATGGTATGATGGAGATGTCGTCGAGCTCCGCATCTATGAACTCGGCGAACGGAGTGTGGTCAACAACTTCTGCCAT
TAGCACAGATTTGGCCAGCATGTCCAACCCCACCAGTCTGCTGCCTCTCGGTGGTGCTGTTTTCGCGGAAAACGCGTTGGTTGACTCGTTAGTGGACCGC
TATCACGAGGTGAACCAAACTGTACTTAATTTGGAGCTGCAAACCGAGCAATTCACCAGACAGATAGCCGTCGCAACATGCCAAGGGCCATTCGCGGCAG
GGAACTTGATGGCCAGCCTCAACAGTTTGCAACCCATACTGACGTCAGAACGGAACAG