Description :
From Genome Similarity Track
Location :
scaffold_14:165324- 167182
Sequence
1858 bases(100 bases per row)
ACGATTCCGGCGCAGACAATGATTTATATGAAGAACGTGCTGCTGAACAGCATGGTCGCCTTCGCTTTGAACTAGGTTCTATATCTTATTAAAAGATATA
ATCAACTACTGATGAGGGACAGCAATATCCCTTTCTTCGTGGTGAGCATAAAAAGCGAGATAGACTCGAAGGGCTGATTGAGCCGAGGAAACTTCCCAAA
ACAATATTATAATTTTAACGTCTGGCGACTGAACTGCTTAGGTTCCATTGTGGTTACGCATAGACCTAAATCGACGATGCATTCGCCCATAACTGTGCAG
CAGAGAAGAGGTTGGTCATAAAACCCACATTTAATATTGGCCAGCAGTGCTCACGTGTGTGCACTGGCAGTCCTTATTTACTAGTATAGTCAAGTGTATC
GTTGATGCCGATGAGATCACCTTATCCGGGTTGCCTCACCAAAAAGCAGATCATGCCCGTAGATCCAGCAAACAAAGAAAAACAGATAAAGTTAATTTAG
ATTGTCTCGTGCTTCTCgtccaaaaaaattaatttgtTGTTTTTCCTGgcaaactacttgcacaagttcgATGCAAAATATGCCGGATTGAAATTACCCC
TCACAAATCTCCTGGGTAAAAATGTCAGAAACTCGTTGGGGAACGACAAAAAGCGACTTAAAAGTCTTATACGTAACCACATTCTGGCTCTCACGAACCA
AGAACGATCATTGCAGCTTTTATATGACGCTTCGGTCTTAAAAATAGGCTGTGTCTTACTTGAATTAGACATCGATAGGCATAGGGGTTTGTGGTATGTA
TAGACCACACGTCGTTGCGTACGTTATAGACGTAATCAAATTTCTCACAGAGCATGACAACTCGTCTTTGAAATATATCTTTTCAGAAATGAACACAACC
GGTTTTATGTGATAGCGGATACGCTCTGGCACCACATCGACAAAACATTTTCGCATACCACCATCGTAACTCTGCCGATCGATGAGGCGATACTTATGGT
TTACGGGTCATACGCAACACGTGTTGCGCAGGTAAAAGCATTCGGAATCCACGTTACGGGAGAATTTAAAAGTTCCTTTATTGAAGCGCGTGGTTGCACG
CTTGCACCGCAATGCCTTATCCCAAGGCTTGTTGCACTACAGCACATACCCGCATGACACTTAGCGCGCAGTGATACGAGTGGGACATCAAGAACAGATT
TCCATTTAAGGAACAGGATATGGCCGCCTCGGAGGAGAAAGCGATACTGCTTAGTAAGCGCTATGCACAAGTGGACCAACATGTAAAGTAGGCCAAACCA
TATCAATGCACGTAGGAAGGGAGTCAAAGGATTACGCCTTCGTCACATGCAGTGGTAGCTTGTCATGTTGGTACTCCATATGAATGAGCCTTATCTGGTC
ACCTAAAAAAGCGTTCAAGAGGACCGGCATTATGGTCTTTGTGAACAATTTGATCATGACGGCTCAAATTGCAGCTGCCATCGATAGTGTTACCAGCCAA
GCGGCTTCTCGACAAAGTTCCAAGCCAACATGGCGTGTCGATAGTCATCGTACCGGATAAAGAACCGCGCTTTACAGCGAACATTTGGCAAACTTTGGTT
GATTTGTTCGGCATTGGCTTTGATATGTCCATGGCTGACAATCAAAAATAGATGATCATACAGAACGTATGGGTCGCATGATAGGTAATATCATCTGAAT
CACTTTCGCCTAAGGCCACGGTGCTGGAGCGAGTTGCTCCCACTAAAAGGGTTTGCACAGAAATAAGGCAGTCCATGCCTCTACAGAATTTGCCATATTA
AATTAACGGTATAGTGAGCCTCTGGGCGCCCTTTGATACAGCCACAAAGTGGCTTCGG