Description :
From Genome Similarity Track
Location :
scaffold_711:1653- 3890
Transcript NameFunction/comments
g9975.t1 propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2237 bases(100 bases per row)
ACGCCGCCCCCAAGGAGAAGCTCTTTGACAAGATCCTAGTGGCCAACCGCGGTGAGATCGCCGTGCGCGTCATGCGCACGTGCAAGAAGCTGGGTATTAA
GACGGTGGCCGTGTATTCCGAGCCTGATGTGAACTCTATGGCTGTGCGTATGGCCGACGAGGCCGTGTGTGTGGGGCCCGCGCCTTCTAACCAGAGCTAC
CTGAGCATCCCCAAGATCGTGGAGGCCGTTAAAGCCACGGGCGCGCAGGCTGTGCACCCAGGATACGGCTTTCTATCGGAGAACAAGGACTTCTGTGAAG
CTCTGGAGGCTATCGGAGTGGCCTTCATTGGCCCAGGCCACGAGGCGATCCAGGCTATGGGAGACAAGATCGAGTCCAAGCAACTGGCCATGGATGCAGG
CGTTAATACGATCCCGGGTTTCCTGGGAGAGATTGACACGCCAGATGAGGCTGTTAAGGTGGCCCAGGACATCGGCTATCCGGTTATGATCAAGGCCAGT
GCCGGCGGAGGTGGCAAGGGCATGCGCGTTGCCTACAATGACGAGGAAGTGCGAATGGGATACAGGCTGTCGAAGGAGGAGGCGGCCAGCAGCTTTGGCG
ATGACAGGATGTTCCTGGAGAAGTTCATTGAAGATCCGCGTCATATTGAGATCCAGTTGATTGCAGACTCGCACGGAAATGTCGTTCCATTACCGGAGAG
AGAGTGCTCCATCCAACGTCGCAACCAGAAGGTCATTGAGGAAGCGCCGAGTGTGTTGCTGGATCCCGAGACCAGAATGGCCATGGGTAAGCAAGCTGCT
ATGCTAGCCAAAAAAGTGGGGTACGTGAGCGCTGGTACCGTGGAATTCCTGTGTGATAAACACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGC
AGGTGGAGCACCCTGTGACCGAACTCATTTCGCATGTGGACCTCGTGGAGCAGATGATCCGCGTGGCTGCAGGACATGAACTACCCAAGAATCTGGTGGA
TGGGCCAGTGAAGATCCACGGCTGGGCTATGGAGAGTCGTGTGTATGCTGAGGACCCATTGCGTGGCTTTTTGCCGTCTATCGGGCGACTTTTGCAGTAC
GAGGAACCTGTCCACCTCCCAGGCGTGCGTGTGGACTCAGGCGTGAACGAAGGCAGTGACATCTCCATGTTCTATGACCCGATGATCTCGAAACTCATCA
CGTACGGCAAGGACCGTTCCGAGTGCTTGGAGCGCATGAAGACAGCACTGGACAACTACGTAATCCGTGGCCCTGGTAACAACGTCGCGTTCCTGCAAGA
TGTCTACCGTCACCCTCGCTTCGTGAGCGGCAAAATTACCACCAAATTCATCGAGGAAGAGTATCCGGATGGTTTCGACGGTGTGAAGCTGACAGCTCCT
GAGATCGAAGACCTCCGCGTTGTCGGTGCGATCATGCATCTGAAGAAGGCTAGCGCTAGCAGCCAGATCTCCGGCCGCATTCAGTCGACCTCTGCTGAAG
GATCTGGATCGTTCGGCTCTCTCAACAAAAATGAACTGGAGTTTGTCTCTGACCAAGCAGGTGTTGTTCCCCGCCTGCGTGCAATCACCCCTGATCTATC
ACCCGAGGAGCTGATAGCTCTCGCAGAGCGCAACGATCTGAAAAATGTGGGTGCTCAGCTGTCGGTTAGCATCGATGGCCCTTTCGGAGAGTCGAAGCCC
GTTATTGTGGTGGAAGTTGAGGTCGAGAACAAGCGGCACCGCACTGAGACGGTGACACTAGCTTTGGTTGACAACAAGTGGCATGTTGTGGGCGGTGTGG
ACTGGTCTCTGAATGGCCCGCTCTTTAAGGCGTCGTACGCGAAGCAGGGCGGGGTAGCAGACATGCCGTTGGCGTCACAAATGCTGCAGACGCTACCTGA
AGGGTTCCGTCTTCAATTCCATGGTGCTGTGCACGACGTGGTTGTGCGCAACGAGCTGGAGGCTGCGTATGGCAAGCACATGCAACCGAAGCCAGAGGTA
GACACATCGAATTTGCTACTGTGCCCGATGCCTGGCATGCTAGTTTCGGTGGCAGTTGAGGTGGGTCAGCACGTGGAACTTGGCCAGGAACTTGCCGTCG
TGGAGGCCATGAAGATGCAGAATGTTCTTCGCTCCGAGAAGAGGGGCGTTATCAAGAGCATTGTGTGCACTGCTGGCGACTCGCTCAAGGTGGATGAGGT
CATTCTTGAGTACGAATAAGCACCCCGACGGTACGTT