Description :
From Genome Similarity Track
Location :
Scaffold_2231:1653- 3488
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_2231-abinit-gene-0.7Gpatch1 protein

Sequence
1835 bases(100 bases per row)
ACTCGTGGTCGTCCGACTTGGTTTTCTTCTTCTTCTTCTTCTNNNNNNNNNNCTGCCAGTATCATTGTATGGCGTTCTCACGCTCGACGGCTATGGGCAC
GGTCGCGACTCCGACTCCGACTGCNNNNNNNNNNTTCGGTCTTCTTCGTGGCTTTGCGAGACGAGCCGTCGGCCTTGCGGGAGGACTTTTTGTGTTTGCG
TCTTCTGCGTTCGTCACCGTCGTCCGACTTGCGGTGCTTCTTCTTGGCCTTGTGACTCTTGTGCTTTCGTGTGTGTCTGTCTCCATCACTACTGCTATCG
TCACTATCGTCACTTGACTCGGAATCGTCCGTGGAAAATGCCACGTCCTTGGGCTTGTCTTCACGACTCACAGTAGGAACTNNNNNNNNNNTTCGTCCGT
GGATAATACCACGTCCTTGGGCTTGTTTTCACGACTCACAGTAGGAACTTCCAGAGGCTGCGTGGTGAGGTGGCGTTTCACGGACGTGACGACTGTGGAC
TCTTTGGGTGCGTCGTCTTTATCCTCCCCATCACGCTCGCTGTTCTTGGCGTCGTCATCATCGCCGTCCTCGTCGACGTCGCTCTCATCCGAAGGCTCAA
AAATCGACCGAAGCAAGTCTGTCGACGGCTTTGGCACATTCGGCAACGGTGGCAACTCCACTTCGTCCTCTCCCCTGGATTTTGACTGAGCTGGCACGGC
ACAGGACGCCCCGTCGCTTCCACTAGTACTCATCGAGCGACGACTCGCAGCGAGGTCCACAAGATGCGGAGCGAGTTCTGACGTGAACAAATCCGGCGCC
AACTCGTCCGACTGCGCACCGCCCGATACTGTTGCGCCTTCGCACTTGACGCGGAAGCGCTTGCACAGCAGCACATGCGGTGCCCACACGTCTTCGCTGC
GGTATGAGCGCTTTTCCTGTGCAATGGGCGCTTTCTCGTGACTCGTCTCCGCGGAGGCGTCCCCAGTCGTCGACGCCGACACAAATCGCTTGGAGATGGA
GGCCATGATGTTGGCTCGGAACTGCTCCGTCGGTGCACTTTGCACAAGCGGTTTACGCTCGCGAGCTGCCTGCGCTGCGCCCATGAGCTTTTCACGCTGG
GCTGAACCCAGCAGGTCAAAGACGCTCCCGGCTTGGGGCTTGGACGACCCAGCCGTCGACGGTTGCTCGCTTGACTCGTCCTCTGTGCGGAGCATTGTTG
CTCGCTGCTTTGCCGTCATCATGCTGCCGCGTCCGCTTTTCTCGGTCGAAAAGTTGAATTTTCCGTACAACGTAGCCACTGTCGCTTCTTGTTCGCTCTC
CTTGAAGACATGGTACGCTTGAAAGTCTGACGGGACATGGAGACGTTCGATTGTATACTTGGGTGGTTTCAGCTTCTTACTGGCGATCCTGAACCCTTCT
AGCGCCGGGCGTCCGTCAGTACACAGCACGGCAGTCGACTTGACGTCATCATGCCGCTTCTTGTCTCGTGCGGAGCTGGTCATAGAGTCGAGCAACTTGG
TCGGCTCGCCCGCGGGGCCAATCGCGCGATCAAAATCGTCCATTGAGGTCGTGTCGTATACGTCCAGATCGTCATTCTCCTCGAGTGCGCTCAGTCCGAA
CCCCATGGATACTCGGCTATTGCTTGCTGCGATCCGTGAGTTGCCATTCCCCAGCGCCTGCGCAAATGTGACGATCTGCCGCTGCGGCTTGTGCTCGTGG
CTGTTCTGCTCCTGTCTCAGTTTGTGCTGCCGAAACTCAGGTGCATCGACGTAGGGATCGAAGCCTGCGCCGTACTTGTCGGTTTTGGGCTTCGGAAAAA
CGCGTGCGTCCACAGTATTCCGCGGTGGCACGTAA