Description :
From Genome Similarity Track
Location :
Scaffold_214:1653- 3166
Transcript NameFunction/comments
Phyke_g6617hypothetical protein PHYSODRAFT_492736

Sequence
1513 bases(100 bases per row)
CTTAACTCACATTAAGTTGAACATTAACTTCCAGATGGCCGCCATGACGTGCAATAGGCACCCAGAGCACCAGCGATCCACCGCCTGTACCAGGAAGACC
CAAGAAACCCGGACGCCAACGGTCCAGATACAGCGTCTTACCACCCAGCGTGGTGATGTTCGATGACCATGACGCTGTACCACCCGCAAATATCTTTAcc
ttgtcgatcttgtcgccaccaGACATGATATTTACAGTCACATCTTCCGTGTCTTTGCTCGTGAAGTTAATGATGACTACCCCATCACCCTTCTTAGCCC
AGGAGCTTGTACTGCCTTTGAAAGCATCCTTCAGTGCATTCAAACCCAGTGTTGCATCTTCCGTTCCATCGTCAATTTCACCCAGGAATTGTGTGGGGCC
ACAAATTGTCTGCAAGTACTCGGCAAACAGGGTCGACAGATCCGTCGGATCCAAACCAGTAACAGCAATGGTAATGAGCCCGTTATCAATCCACTTGTAC
GCAGTATTCTTCTCATCCATCGACGTGCCGTTGCTGGTTTTTCCACTTCTGATCAAGTCGTTGATAATAATACCGAAAGTCTTTCGCAATGTTTCACGTG
TGGTGTAGGCGGTTGTTTCGGAGGACTCGGCTGACATTTCGttcatgcagttgttggtAACCGTGGCGACGTCGTACAGCACGAAATCAGACTCACTGAT
CTTCAGGCGTAGGTCGCCATCACTGATACCAGGTTTTTCTGCCCTGTACTCATTCACTATTTGCCACGCTCGGTCAACCAAAGATTTCATGTCGAATCCA
CAACTTGAGTTCTTCTGCATAGCTGTTTCGAGGTTGGAGATCTCACCCTCAGTAAtctcctcagcagcctcagTGAAGTTGGCCCCCTTCAAGAATGCCT
TAAACTTCTCCCAGCTCGAGATAATATCGTCGTCGTGTCCCAGAACATGCAGGAGGATCCACTGCGCAGTTGATAGTACACTCTGCGATAGACGAAGGTT
TGGTGGTATATCCTTGCCCAGACAAGCATAGATGGCAATGGGCAAGTCAGTAACCACGTTGTTCGTCTGGTACAACATCGTCAGAAGTTTTGCCTGTGGC
GTTTGAGGGTCTTCAGTCATTTGAATACGCGTGAACAGGATGATGCCCCTCAGCACAGAGAGCAATGAGTTCGTGCATTTGACGGCTCTTGTGACAGTCT
TCCCCAGCTTTGTCAGCTCTCCAAACACACCAAAGGTGGCCATGCTCAGAGTCGACATCGCCACAGCAGAGGTTTTGGCAAGAACTTCACGCTTGCAGTC
GTTGTTCTGTTGAATGCACTCCATACCACATTCAACCGGGTAACCGAGCGGACACTCCGTCCAGCAGGTGTTCGTTAAGTCATTGCGGTCGAAGTTAGAT
GGACACGTATCCATGAAGTGAGCCTCGCGGTAACAAGCTGCGTCCGGTGAGAGACTCCAAGGACCCACCCAGTTACGGTGTGTCGACGTGATCGTGCTCG
TCGCTGTGGCGGG