Description :
From Genome Similarity Track
Location :
Scaffold_245:16527- 21191
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_245-snap-gene-0.12Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_245-fgenesh-gene-0.7Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_245-snap-gene-0.13Putative cortistatin
Pytap_DAOMBR444maker-pag1_scaffold_245-snap-gene-0.14Kinesin

Sequence
4664 bases(100 bases per row)
TAGTCGTAGTCGAAGCCGAGACCGTGACGGCGGCAAATCGAAACGCCGGCGTTCTCGTAGTCACAGTCGGGATCGAAGCCGAAGTCGCGCTCGAAGACAA
CAACGACGTCGCTCAAGGAGCCGCTCGCGCTCGACAAGTCGCACTTGGACTCACGACGCCTTCGAGAATCGCAGTCCAAGTCCAATACGGGAgATCGATC
CGGGATATCATCCTGAACTGGAACAATGGGTTTCACGTGCTGgTGGGGTGTAtATTCCTCGACGGAGCTGATCATGAACAGGCGTCGATCCCAAATTGGA
CTAGATGCAGTTGGCGGTGAGAACGACAAATAGACGAGTGTAAAAGGTGACGAAGTCGAATCAACTCCCACTCCACTCAGCGATCATTATGTCCCTTTTG
CGAGAATGGGATGAAGGTAATACGAATGCCTTTTtCCACTTCCTTGTCGTGTTGCTGATCTGTATTGTGGTATTGCGTTCCTGTCGCTGACACTGATTTA
CCGTTAGCTTCGAAAGCTCGCCGAAAAGAGATTTTGAAGTGGTTTGACTTTCGATTCAGTCGTGCTTGTGATtACGGTGAGCTGGAGCATGAATGTGGTA
GTGATGTTTCCCTCCTCCTGCCGCGGaTTCTGGCTTGGCTGGATAAGATCGTCGCCAAGGCAAGAAAGTCCACTTCGACAGCTATGAGAAGCGCAGTGAA
TGTAATCGACGCGTTGCTCGGCAGTGTGAAAGTGTTTTTCCATCCGACGAATATTCTTGTGTATCTGCATGAATTTATGCAAGCAGACGGACTACGCATT
TTACTCCAGACACTCGAGTCTCGGGCACCCCTCGTCAATGATCCTCATCGGTGCATCATTTACGGCATTGTGCTGCAGATCTGTCAACGTGGTGATCAGT
TCAAGGAAGCAATCAGCGGGCTGCAGGGAGAGATCGCATTAGTTCGTGGCGCAATCGCATCCAGCAATGGGGCCAACTTGCAGTCCAGGGTATGGCGGTT
ATGCCGAATGACGCTACTCCAGCAAATGGTGGGAAATATTTCGTGTATCACTGCTACGCACGAAGCCATATTATTCATGATGAATCATGAAGCGACGCCA
GTTCGGGTACTCGGGCTTCAAATCACACGCGAATTGTTGAATCAGAGCTCGTTCTACTTTGACAGTTGTTATCAGAAATCTAAGCAAGACGATTATGTGG
GGCTAAGTGTTGCGCTACTCCAGGCTGACAGCATACCACTTCGACACGAGGCTCTTGAGCTAGTTCATTTGCTACTTCTCGTCCCAGTCCTTCGTGTGAG
GCATTTTCCCCAACTGGATGCTTGATTGGGTACTGACACTTTGTTCGCATCACAGCTCCCGCTGTGTTCGTTGCTCGCTAGATGGATTCACGATGCTGCT
CTCGCTCCAGACATGTGAGTAGCTGTTCCTAACTGCCTAGTTCGTGTTGACTCATTGtCTACTCTCATTAGATTAGATGCTGCGTATGAAGCTTCACGGC
ATACTCAAGAGTACGAAaTGTACATCCACATCCGATCGCCTTtCGTTCGATCTGCTCAAGCACTTACGTCTCTCATGCaCTCTGTGCCtCGCATTATtCC
CCTTCTTGTACAGAAGTTTGAAATTTTGATCCCAATAGCCTTTATCCTGACCATtGAGCGCCCGAAATCACTAAGGTGGCACGCAAGCTTGGTGgCCCTC
cATTTCATCTTCAAACATTACCGAAGCGTCGCAATTCATCATCTATGCCAATTATTTGCAGGTAGCTATCAAGAACTTGATTCTTTGCCTCTCCACGTTA
CACCGGACGTCTTGGCTGAGGCACTGCTACGTGACGACACGCACCGCCGAAGTCTGGTTCTGCAATTCTATAGAAATGAATGGGTTCGAGAATTCCCTGA
TGAAAGCTCTAAAGAACGACAGAGTGAAGATGATGAAGAACTTGCGGTGATTGAGCACACTATAGAAGAAGCCGTGGCTGTGATTCTTCCAACTCGCCAG
TTGGAGCTGCCACCGAACGACTTTGGGAGTGAGGACGATATCCAAATGGAGGCAGACTTCAGTGTGGAAGCAGAGGAACGCATACGTCAGAAGTTAGAGA
GGCACTTTCATGCATTTCGCCCATTCAATGGCAACATAGCATCATAACCAAAGCCGTCCAACGCATTTTATGGTGTCAATCGTGCATGTATATTAGAAGG
ACTCAAATGTCATCCGGTGCGATATTCTCGTCAAGGTATCGAGAGATGGACTGTAGCTGCTCCAGCACAATCTTGACCTTCTCACGTGCGATGGTCGCGT
CCTTTTCCGCGCCGTATGTGCTACGGCCGTACGTGCGGTAATCCGAGACCAAGTGGATGTGACCCGCCAACTCCGTGTGGATCTCCTTCACAAGTTGCAA
GAACTCCGTCGTGGCCTTGTTGAATGCCATGTTGGAGGCCTCTTCAGACGACTTGCGAGGCGTCAGGTGGTTGATCGCCGACGCGGCCGTACGCAGCGCA
GTCACGAGGTTCTGGAGACAAACACCTCGAACGGTGAGCACAATTTCTCCTCTCGCACTCAATCCCAGGAGCCCACAGAGGCGTAATTCAACGCACCTTC
TCTACGTTGTTGAGTGAGTGCAGCACGACGGCGTGGCGCGAGCCCGTGAACGGGTCACTGCTGTCGGAGAAGTGCACGCGGCCGTCCAGCGCTGAGTCCA
TATTCACCCGATGGCAAAAaTGCACTCACTACCCTGCCCTGCAGTATGCGATATTGCAGAGGACGGTATAGCACGTAACAAAGGTTTTATGGTCGTATCA
AAACCAGGTAGAAGTGGAATATCGAGAACCAACCGTGATTTGGTATTCGTGTCTGATATGACGTGTGACTTGTGACAATGGAACGAAGAGCTCTTCATGG
ATGCTCGCTGTTGATCTTCCTCCCGCCTCCACGGTCGCTGCATGAGCAGGAGAGCGCCCATGACGTCTCATCTCATCTCAGAATATCCGTCCGCCAGGTG
CTCACCATTTCTCTCCCAGACTCTATTTTTCGCCTGTTGAGTGAGTGACGCGGACCTCGTCCGAGCTTCCGCTCTCTCACAACGGAGGCATCTCGAGGCC
ACGACCATGGACCACAAGGTCACGACCGACTACACACGCCTACTGCACAATTCGAATGTGAAAGTGTACGTCCGTGCACGACCATGTGCCGATGGGAATG
AGCCGTCCGAGGAAATGTTCGAGCGGAAGCGAGAcGCCCCCAATAACATTGTCATCAAGGACACGGAGCGCATGCAGTACGGTAACCATGCCTTTTCGTT
TGACAACATCTACTGGACGGACACGTCGCAATCGACACTCTACGAGACAGTGAGTTGCGACCGGTCTCACATTGGGTGGATCTTCACTTAGAGCTACCAT
GTACTCGGGCAGACAAGCAAGGTTCTCGTCGACTACGCCCTCAAAGGCATCAATAGCTGCTGCTTCGCGTACGGGCAAACCGGCTCCGGCAAGACGTTCA
GGTGAAACCAGCTAAGTGTATGGAAAGTTGTCCGTCCTAACGACTTGTGTAGTATCTTCGGGGAGTCGGGGGACAAGGCCGGCATTCTGCCTCGCTCTAT
CGAGTATTTGTTCGATATGATCGAGCGGAACGACACCAAGTCACGTGAAGTGACGCTCGTAGTGAGCTTCTTGGAGATCTACTGCGATCGGGTCCGCGAT
CTGTCGCGAGAGTATCTGAAAAAGTCGGGgCGCGCAGTGTCTTATCAgACGTCAAGTAGTACCGAGTGGTTCCTTCGTCAGGTTGTCCTACGAAATTGAG
ACAGCGACGCAACGAAGTAGACTGACGAATGtGTGTTATTCTTCAGCGCCAAATGAACCGAACGGAGTCGGCTTCGAGCTTTGGATCAAACCCGACCAGC
AAAGTAGAAGAAGAATACGACTATGAGAAGGCCAACTTCGAGATCCACGAAGACCCACAGGGCCGTGTGTTCGTGAAAGATCTGACGATGGCTACTGTAA
CGTCCCGTGAAGAAGTAGACGCTCTCGTGCAGGCTGGGCTCAAGCTCCGGGCGACACATGAAaCTAAAaTGAACGCAGTGTCCTCGCGATCACACACTGT
ATTCACTATCCACGTGTTtCAACAGAGTAAGTTAGTCAACTTCAGTGCGTGCTCAATGATCTCGAACTGTGTCAGCTAACCATCCTCTAaTCAGTTCACG
ACACGGACGAAATCATCTACGGACAGCTCAACATGGTGGATCTGGCCGGTTCTGAGCGTCTCAAGAAGAGCGAATCCGATGGCCAGCGACTTAAGGAAGC
ACTGCATATCAATTCATCATTGAGTGCAGTTGGCAAAGTCGTAATGTCTCTGGACCCAGAGAGTGGCTACAATTACATTCCTTATCGCGACTCCAAGCTC
ACGAGACTATTGCAAAACAGCATCGGAGGTAACTCCTACACGATCCTGATTGCGACGATTCACCCCATGAAAGAGCACTACGAAGAGTGTCTAAGTACGC
TGCAGTTtGCCAATCGATGCCGGTCCGTCCAGAATCAACCCcGCGTCAACCATATCAACGGgTCCGTCGCAGATAAAGACCGTCGGATTCGCAAACTGCA
GGAAGAACTTGCCGCTCTGAGGCGGCAACTCGAAGGGCTGCGAGCTGAGTACAACGGTCGTTTT