Description :
From Genome Similarity Track
Location :
contig_2:165267- 172625
Transcript NameFunction/comments
g467.t1hypothetical protein F442_05499
g468.t1hypothetical protein PHYSODRAFT_488328
g469.t1hypothetical protein PHYSODRAFT_328487
g470.t1hypothetical protein F442_05492

Sequence
7358 bases(100 bases per row)
GTCAGGCGCTGTACCGGTTCTTCCTCTCGCGGAAACACGCGGCCACGGGAGCCTTCACAGCTCACGATGGAGGGTGCGTGGCGCTGTGGTTTTGCTGTAT
TAAGCAGCTTTGCGTGTAATTAAACGGTCTTCTCTGTGCCCAATCTGACAGGGAAGTGGATGTCCGCGTGACGTACTGCGTCATCTCCATCGCTAACTTG
TACGGTATCCTGACGGATGAACTGAAGGCTGGCGTGGTGGACTACGTGCTGTCCTGTCAGACGTACGAGGGCGGCTTTGGTGGCGAGCCGGACAACGAAG
CCCATGGCGGCTACGCTTTCTGCTCCGTGGCGGCACTCTACATTCTCGAGGCTGTGGGTCAGATTCGGGACCTTCCTGGACTTCTGCATTGGCTTGCGAA
TCGCCAGATGCCGTTTGAAGGTGGCTACCAGGGACGCACGAACAAGCTTGTGGATGGCTGCTACAGTTTCTGGCAGGGTGCAGTGCCAGCATTGCTGGCT
GACGTTGTGCGAGAACGGTACGGTGATGACGTGCCGTATCAATGCCATCAAGAGCAGTTGCAGAAGTACATTCTGCTCTGCGGACAGGAGATTTCTGGCG
GACTACGAGACAAGCCCGGCAAGCCGCGTGACCATTACCACTCGTGCTATTGCTTGAGTGGTTTGTCGGTGGCACAACACGGAGATGGCAAAGGCGAGCC
GGTCGTTTTTGGAGATGCATCCAACCTGGTGGCGCGCACGCACCCAGCGTACAACATTGGCTACGACAAGGCTATGAAGGCAATCGCATATTTCAAGGCG
AAGGGCCCCTTCGAACCGGAGTAGAGCAGGTAAAGTACCATGCCATAGATCCTGCGCAGAATGGTGCCAAATGGAAGTTTACCTGGTCGATGATCTTAAC
AAGCATTGCACTAGGCATTCACTTTGTGTTTTTGCGTTGTCATTTGTTATAAGGGTGGAAGTTTCTCGGCTGTGTCGTCGCCATTAGCATCACTACTAGT
ATCGTGGTCTTTATGGTTTATGCTACGCAGGGACGATGAGGCTGCCAGCTTGGGCAAAGGAGGCTGAAAGTTCGAGGTCGATGAGTGTGAGCCGTGGTGA
ACAGGATGGTGCGAGTGGGGAGATGGATTTACCACAGTTAGCGAGGCTTTCCGCTTTTCTCGATCCCGGACTGACAAAATCGTAGATGGCGATGAAGCTG
CTTCAGTCAGCAAGATTGCCTTCGAGATTGATGATCCACTCCCCACATGCCGCTGCGCTCTCGCTTTGGCTCGATCTTTCCGCTTCTGCCGCTGCTGGAA
AGGGGTCAAGTTCGAGCCCTGACTGCTTGCAGACCCACTTTCCTCGTCGGAGCTCAAGTTTTGTGGAGAGTTGGAGTGAGTTCCCTGAATGAGGCCGCTG
CCTTTCACTGAAAATGGCTGCTGCTTGGGTTTGGCTTGGAGTAGCGTGGGCTTCAGCTTGCTATGCGCCAGCTTGCCTTTGGGGGATGGCTTCTTGTCGG
CTTGTACATTTTCCGAGTTGCTATCTTGAGGAGAAGCACCCAGGTAGTGGTCAAGTGACATTCCACTCACGTCGGACGTCGGTGCAAGCTTTTTCACCGT
TGCAGGAAGCTGAGGTGGCAATGCCCGGAGAGATCCTGCTCTGGGCAGCTTTTCCTGTGCAATGGCATCGACTTCATTCACGTGGAGATAGTCGCTCAGC
GTCATACCCGCGAGCTCAGACGGTGGCTGTGCCTTTGGCGTGGAAGTCTCGGACTCGTAGTCGTCTTCGTAGTCATCTTGCTCGCTCTTCCGCTCCGATG
CTTTGGCACCTCCCGTCGCGAGTATCCGATCCGGGCCATCCTTGTCTTCGCCTCCGACTTTTTCAGCTGCCATGACGTCGTTGTCGGTCGAGTGTTGAGT
AAATGCTGTGACACATGACCGCTCACTTTGTGTGCAGCGAAGTAGTCTTCTAAGGTGGAACCTGCCAGTGCGTTCCCGTCGTCGCCGTCGCCATTGCAGC
CTGTCTGTGTATTCAAATGTTGCTGCTGTCCCTTGCCCATGGTACTGCAACCTGGCCGCCATCACCCGATAAGCCTGAATCGAGGGTGTAACGACCATGC
CGAGCTGAGTCGTTTCAAGTCCACTTCAACTTGTTCTGGGTTCGCTTTTAGGCGAGAATGTGATGCTTAGAGGTGGATGGCAGACTTCACAGCAGGGTAG
AATGTTCAACGAGAGAAAGCAGTGACCATTGCGAAACTGTTGTTGATAAGCTAGCAGGCTGTGTAATACATCAATCAACTCGCGCCGAGTCAAGCAATCT
CTAGTCTTTCAAGCTTCGCTGATCCAAGGGTTAAGGACGTCTGGCTGGTAGATTTCTACGCTGATGAATACCCTGGTGTAAATTCTTGCAATCACCACTG
CAGTACCTTGAATCTATGCTGGGTTCTACCGTGTTCAGGATGGCGCTGCCACCGCCAAATACACTCAGGTTCGGCAGCTCACGCAGCAAGCTTGTTACCA
AACCTGAAAGCTAGTAACCCTTCGTCCAGTCGACTTGGTAACGCACGGGTTCGCCCTTGAGGTAGCGGTTGAAGTTGTCCAGGAACATGGCTGCCACGTC
TTCGGGGAAGACTTTGCCCGACACGTGCGGCGTCAGCAGCACCGAGGGGTGTTCCCAGAGCTCGCTGTCGTTCGGAAGCGGCTCCTTCTCAAACACATCA
AGCACGGCACGCGACAGTGTGCCCTTGTTCAGCGCGTCAATCAGTGTTTTCTCCGAGATGACGTCTCCACGGCCAATATTGATGAACACAGGACTGCGCG
CGCGGCATTTCTCCAGGTTCTCCTCGTTCAATAGATACCGTGGGTTTGTGCTCGGAAGAACGTTGAGCAGGTAGTCGCTCTTGGATAGCAGGTCGTCTAG
ACTCGTGGTGATGTGATCCGCGCACTCTGCAAGCTCAGCAACGTCCTGTGCACTCACGTGGCGCTTGAACCCCAGCACTTTGTAGCCGCAGCTGCGCAGC
ATCTTGCCCGTGTACTGGCCAATGTCTCCGAGTCCGAGGATGCCCACAGTGACGGACTGGGCAGGTCGAAAGCTGATCATCTCGACGCGTGCGTAGTCGC
GTTTGCTTTGGAACTCCTTGGCCTCCAGCAGCTTCCTCTCGATCATAGTGACGTAACCCAGCACGTACTGCGCCATGATCCGCGGCATCATGCCGCCGGC
CCGCGTCAATGTGAACTTGGGCAGCTGCTCTGCGGTCAGAGCATTGGGTCCCTTGGGCAGCAGGTTGAGGTACATCTCCACGCCGGCGTAGGTGGCTTGC
ACCCACTTGACGTTGCTCAGAATGTGCTGCTTATCCTCCGGCAGGTTCTCCTTGGGGTCGAGGAAAACGGGGCCACCGCCGTGGGAGTCAATGAGCACGA
TCTCCGCTTTCTCCACGACGCTTTGCTGCTCGGGCGTGAGGTCCCAAATAGGTCTACCCGGGTCCACCATGCTTGGTCCGTGCAGTGGGTCCTGCTTGTT
GCCCACCAACTGCGGCAGCGGGATGTCCACGAGTTCCAGTTTGCCAGCCCGGTAGAATTCACCTGCAGGAGTCTCGGAAGCAGCAAATTCCTTGCGGACA
TTGTCTCCAATGCCGGCAATAAACGTCATGATGGGCACCCGCATACACGAAGCAGTCGCGACGGAATCGCCATTGGAAGACGTCGTAAACGCAGTCATAG
CAGCGAACTGGCGAGTCGTTCGAGGCACCTCGCAAGATCGAAAGTGAGCTCCTCAAAACGGCAACGTATTTTAGGAGTAGGGTTATCAGATGGATACCCC
TTTTTCAGCAACGTCAAACCTTACAAATATCAAGTAACAGACTATTGGTTGCGCAATGAGAGTGTATGCTTTCAAAACACCATGATATGATGAGCGGCTG
GAATGCAATCTCCATTAGGATATCCCACCACGTGTTGGTAATTATCTTGTGCTCATGCCTGCGGCCTCGAAGCTCCGTGTTCCCATCGTGTCGTTCCTCA
ATGGAATGGGAACTGCCATTCGCAGCGAGTTCGCAGCGTCTTCCACCCCCGCCGGAGACCTCTTTCGTGCTGGAAAACTGCAACTCGTGGACGTGCCCGT
GCCAAAGTTAATTGGCAACACCCAAGACCCGCTCAGCGGCCACAAGATGGACGACACGGGAGCTCCTCAGTGGGATCTGACGTCTGAGCAGCAGCGCGTC
ATCGAGCAGGCCAAGATTGTCGTGATGGACCAACATTCCGGGGGGCCGCTCTTCCTCACGCCCGAGGAAAGTCTACCCAAGGACAAGAGAGACATCCTCC
GGAACATCGAGTGGGTTCAGGGAACGTATGCAGGTGTGGAGCAGTATTTGAACCGACTGCCGCACGGTAAGAACGCACTGCCGGTGGATCAACTGCCCAA
GTTCACGTTGACTCGTGCAGGAGGATTTCTGCCGCGGATCATGGGCCAGTACGTCTTCGGATACGTCACGATGCTGGAGCGGATGCTGCTAGAAGCGATC
GACTTTCAGCGCAATCGCACGTACGAACGAGAGCGCATGATCGGGTTCAGACCGGCGCAGACCGTCACGATTGGTATCCTCGGTCTCGGAGACATTGGCC
AGGGAGTGGGCAAGATGCTGCGAGCGGCAGGGTACAAGGTGCTGGGCTTCAAGCGCCGTGTGAACTCCCAGCTCGACCTGGCGTTGGCGGCCTGTGCGGA
TCGCGTCACGCCGGATCTGGACGAAGTGCTGTCCCAAAGTGACTATTTGGTGAACGTGCTGCCGAGTACGAGCTCGACGCGCTACTTGTTGAACGAAAAG
AACTTGGAGCTTTGCCGAGAACGCAAGCCAGTTTTCATCAACATGGTCGGGGCGACGTCGTTGCTGAAAAGACAATCATTGACGCTCTTGACAACGGTGT
GTGGTCTCGCGCTGTTCTGGATGTCTTTGAGGAGGAGCCACTCCCGCGCGAAAGTGCGCTGTGGGCCCACCCTTCTGTGCTGCTCACTCCACACGTGTCT
GGCTACGTGTTCGTGGAAGACGTTGCCAGTATGTTTGTGGACAACTTTGATCGGTATTTGCGCGGAGAGCCCGTGCTGTACAAGGTGGACTGGACGGCAG
GGTATTGAAGACTCGATCGTGCTGGCGCTGCTTTGACGGAGTCAACTCAGCACAAGACGAGCTTGAGATGATGTCGTAGCTCTGCTGGACGTCGTATTTA
GATATATGCTCGAACTTTTCAAAGTGCTGTGAATCCGCGTGTGTTCAACTACCATTTGTTGGCTTCTTTTTTTCAACATTTTCCAATTGTGAAACCAAAG
TGAGTCCCTGAGCTGGGATCTGCTTGCCATCATCGCAATCACCCAGTCGATAGCGCCGCCACCAGCTCGTTGTGAAGACGTTGGGTAGTTATTAAGAATG
CTTGTAGCTCAGGTGTTTTGATATTGGTGCTTCGTGCCACGATGCAAGCCGCTCCAACGATCTATAGGATACGAGAATTCAGATTTTTTTGGGGGTAAGA
CGCATTAAAAATGTAGTACTTACCTCGTAGAGCACGAAGTCTGAGATAATAATTAGTGCAAGGACGACATGAAAAGCGTCCATTGTTATGTGTTTTTACA
TAGTGGTTAGATACGCCTGTCTTCGCAAAGATTCTAACGAACTCCACTGAGTTGCAAGCAAGTGTGATTATGCTAATGCATTGTATTGCTATTACCAGTG
ATACAAATGTGTCGGAGCCTGGAAAATTTCTTTTCATTCGTGTAGTACAACATCTTTATTGAGTTCGTGGAATACAAGGAATCGGAATACAAAGAATCCA
CACAAGAAGCTCAGTACCCCTTCGTCCAGTCCACAACATATTCCAGAGGCTCGCCACGAAGGTAGTGATTGAAGTTATCCAGCAACACGGGCCCGACATT
TTCCGGAAACACTTTGCCTGAAACATGGGCGTCAAATGTACTGACGGATGCGCCCACAGCCCGCTCACGCGCGGCAGTGGCTCCTGTTCAACACATCCAA
CACGGCCCGAGATAAGACACCTGCATCCAGGGCATCCAGCAGCGTCTTCTCGGAAATCACGTCTCCACGGCCAATGTTGATGAACACGGGACTTCGTTCA
CGACATTGCTGCAGATTCTTTTCGTTCAGCAGATATCGAGTCGCGCTCGTGCTCGGCAGCACACTGACAAGGTAGTCACTGTTCGCAAGTATATCATCCA
AGTCTGTCGTGATTCGATCAGCGCAGAAAGCCAGATTGTCAGCCTCCTTGGGACTTGAGTGGCGCTTGAAGCCCACCACGTGTACCCGGCAGTACGCAGC
ATCTTACCACACCTTGGCCAATGTCACCAAGTCCCAAGATTCCAACCGTCACAGACTGCGCCGACCGGTAGTTCACCAGCTCCATCCGCGCAAACTCGCG
CTTGCTCTGGAATTCCTTGGCTTCCAGCAGCATGCGCTCGATCAGAGTCACATATCCGAAGACGTACTGTGCCATGATCTTGGGCATGACACCTCCACCC
CGAGTCAATTGGAACCGGGGAAGCTGATCCAGTTTCGGTCCGTTGTCACCTTTGGGCAGCAAATTGAGGTACATCTCGACGCCGGCGTAGGTGCCCTGCA
CCCACTTGACATTGTCGAGGATGTGCTGCTTGTCACTCGGTAAACTCGTTTCGGGGTCGAGGAACACTGGACCTCCTGTATGTGAATCCATGACCACCAC
TTCCGCCTGTTCCACGACCTTGTGCTGCTCGGGCGTCAAGTCCCAACGAGGCTCGAGGAGGTCCTCTCCACGCTGATGCTCCGCATACCCGGCGTCCTGC
TTGTTGCCTGGAAGTTGCGGCAAAGGCATTTCCACGAACTGCAGACCCCGGACCTGAAAAGTTTTCCAGCGGGTGACGAGGACGACGCAAACTCTTTTCG
CACAGTGTCCCCCACTCCGCGGATAAACGACACAATGGGAACTCGAAGTGCTGCCATGGTCTCCGATATCTCAAATGTGCGGTGGGAGAATCAACTTCCA
ACAAATCTAGGTTTGATTTGCTAGGATTTCAACTAAGTGCGAGTTGAAGTGTACTTGAATGTCCAACCCTGTTTTGGCCTTCTAGCTGTCTAGGTGTCTA
AATACATATAGGCAGTGTCTGCCTGGTTGCTCTACTCCTTGTCGTTCGCGAGCGGCTCGAGGACGGCACCCCACCGAGCGTCCGTGGCAACGCGCACGGC
AGCCTCGTAGCTCTTGCTGTGGGGGCGTCTCGAGCCAGTCTTTTGAGCAAAAGCAGGGACGGCGCGCTTTGTCTTTGGAGCAGCAGTCTTGCGCTTGGTC
ACACGCGACGGGATGCCACGCACGCTGGACCCAGGCGCACCAACAACGCCCAAGCCCT