Description :
From Genome Similarity Track
Location :
Scaffold_282:16525- 18708
Sequence
2183 bases(100 bases per row)
ATCTATACCAACCAATGAGCAGTGTATTACTTCTGCACCACAATATTACTCTTTAAGCCAATATTGTGAGAGTTCAATGTCTGTTCTAACATAATATTCG
TACTAGATATTTAACTTTATGTTAAGTATTATGTAACGGAGGCACCCCGTTACATCACCCCCCCTTCACCAGTCACATTAGTGACTGATTGATGATTTGA
GTGACTCCAATGAGTGACTCTGGGACAAGGAAACACTAGTTAATCCTTTCCAGCCATTCCTTCAATCTCATCGCATGGTTAACAAGTCCATGCGGTGTGC
AGCCAAAGATGCCGTGGTGAAGCTATGATACTACGATCCGCTGCCGCGGATGAAGCTAAGACATTGAATGCAGCAGGTGACAACCCGCCTGATGCTTCCT
CTACTAAGCCTGCAGCAGTCACTACTGTGGCTCACGCGGTGACGCACCGCGTGACATCGGAGATTAACGAGCTCGAGCTCATATCCTGCGGTGAGTCGGA
TAGCGACACCGAATCGACGAAGACAGCTGCAAAGACATAGACAACAGTGGCTAATCCAGAGCGAACTAAGTCGTTCTCTCGAAGCGCTATGAGCCTCGCT
AAGCGTCGTGACATCTTCGGATCGTCCGACGAGTCCGACGCTCCGTCTCCAAGGCGGAGTCGTTCGCTCGGAGTGATCGAGGAAGTGGCAAGAGCCAGTT
TTATGATGGTGATGGTGATGCAGTTATGCGTCACGATCAGACGGTCGTACTGGTCGTATTGTCGGTACTTCTATTAACACCACGCAAGAAGACAGAGATC
GCTCCACCTTGCGCGTCGCTCCCGAGAAGAAGGCGTGGCTGCCTCCTCAGCGAGTGTTGGATCGCTTTTCCGACACGGTAAGTGATCGTTATCGGATATG
ACTATTCGATTCATCAAGGCTTAATGGCCTTGACTCTAGTGCGAGTGACTTTCGCACTGAGCATGATTTCTATATCGATGTATTTTCTTCAAACATAGAT
GTTACAGCGAGAGCCATAAACGTGACGGCACCTCGCTGAACCAGGCGTCGAACGCGTTCATCCACAATGTTGGGGAGATTGGGCGCGAAGCCTGGCTTCG
TAAGCTGACCCTATATCGCAATAGGTTTGAGAAGCGGGCTTCTAGCGGTGCACGTTACAAACTGCATCGGATATCGAGAGAGGACGGGTTACCATGCCTC
TCCTGGGGTGATGCGTGCCAATGGTTTATGAACAACTTAGCAAGAGCTCTAAAAGAACCTTATTCTATGACCGACCCCTGGTAGAGGGCTCGTGTCTCGT
CAGAGATTTACGAGGGGATAGATAATTTGCAGTCCCTCTGCAAAGGCGCTGGGCGTTCGTTCTCCGATAGGCCTTCTTCAGCAATGGATGCGCCTTGTCA
TACTGCTCGACAAGGCCCAACACATCCATTATCAATTGCGAGCGAGCCTTCCATCTATCCGTCGAGGGAGGATAGCCGCGCCACTGGACGAGGTAACTCG
TACGACGTCCTTTCACATTGTGGTGGTTCAACAGTCGTTCCACAAGGAAGCGTTGACCACCGCGCGTATCAACTAATGGATGAGGTGGAGGGGCAAACAC
ATCCCCCGATGAATTCGCTGGGCCAATCTGATGCTGTGAGTCAGCTCGACCGCGTAACGTGTGAGTTGCGCGAGGACCTCGAACAAGAGAGGGGCAGAAG
TCTGGATTTGATTGGCAATGTGAACCGTATGAGCTCAGATCGGGAGGAAGACAGGGCAGAGTATGCCTTTGACCATCTTGCGAATGAGTGGACTCAGCGT
TCTCTCCGCGACGAGCTGATGGAAGATCGTCAGAAGGTCTCTCGGTTTCGCGGGGAGGTATCCGAACTTCAGACGCGGGCTGAGAGCCAGCATCGCGAGT
ACAAGTATCTGTTGGAGATGGTTGAGCGCAAGGGCTTTCTTCACCGGACAAAGTCTCGTACAGATAGTACGGCCTAAGGCGACCGACGTAGAACGTAGGA
TACGTTCGCATCTTACGTGGTAGTTCAATCGTGTATGCGTTGCCTAGGCGGCGCAGCACACTAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTAC
CCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGCAGATTGTAGGACTAAGTCTCCTTCATTGAATGAAAGACCATTTACC