Description :
From Genome Similarity Track
Location :
Scaffold_24:165237- 166674
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009043Similar to HXT3: Low-affinity glucose transporter HXT3 (Saccharomyces cerevisiae)

Sequence
1437 bases(100 bases per row)
AACGGAGACCTGGAAATTTGTGATCTTGTGTGACTAGATCGCAAATTTCAAGATAATGCGTACAAGAGAATTGATTAATGAGAAGTAGCACATGAGATGA
AAATGCAAAATCTGTGGTCTTCTTTGGCATGCATGTATGCAGGGGACTTCGAGCAGCCGTGCTTGGATTCACTTGTACGCGTAGAAATTCGAACATGTAG
CGTAATCGCATGTGGCGAATACGCATGTTGACGCAGAACTTAAGGACACCACAGCAGACTACCCACCTCAAATTGCGTAAGTTTTTCTCAATTAGATCCA
ATTGAGACGACACCTCAGGTGTCGGCGTGGTCTTAGGTCGTATCAGTAACTTTTCCCGTTCAGGTATAATAGAGTCAACGTAACCAGCATGGATTAGTTG
CATCGGCAATTTGCAGTGAGTAGTCACACTCAGAAGTAAGCAAATGCCACTTCNNNNNNNNNNNNNNNNNNNNGAAGTGGCATTTGCTTACTTCTGAGTG
TGACTACTCACTGCAAATTGCCGATGCAACTAATCCATGCTGGTTACGTTGACTCTATTATACCTGAACGGGAAAAGTTACTGATACGACCTAAGACCAC
GCCGACACCTGAGGTGTCGTCTCAATTGGATCTAATTGAGAAAAACTTACGCAATTTGAGGTGGGTAGTCTGCTGTGGTGTCCTTAAGTTTCGCGTCAAC
ATGCGTATTCGCCACATGCGATTACGCTACATGTTCGAATTTCTACGCGTACAAGTGAATCCAAGCACGGCTGCTCGAAGTCCCCTGCATACATGCATGC
CAAAGAAGACCACAGATTTTGCATTTTCATCTCATGTGCTACTTCTCATTAATCAATTCTCTTCTACGCATTATCTTGAAATTTGCGATCTAGTCACACA
AGATCACAAATTTCCAGGTCTCCGTTGCATACAGAACGGCCCTCAGAAGTAAGCAAATGCCACTTCGATTGTCAAAAAGTCACTTCAAAAGTTTATCTGT
GTGGGCGTATCTAAGAATGGGTGTACGTGTCTGCATGTTAAACAAAAGGCAAGCTTTATCACCTCGATGCCGATACTTTTATTACAAGAACAGTCTGGTT
CCAGCTATGTCACGTCCGATACACACGCATGCAACCTCTTGCTACTACTCGAGTGAGGAAGTTAATGTATACAATGAAGAAGAACGGGTTCGTTCATTCG
CTGTAGAGTTTCCATCTCTACGCCTGCTGGACTGGAGTCTCGACTTCGACGTATTGCGGCGACACGCCAGGCTTCTTGCCGCTCTTGTGGAAGAGGTACT
CGATGTCTTCGAGAAGGATTCCCTTTGTCTCGGGACACAAGAAGTACACGAAGATGCCCGAGATACAACAAGTGCCGGCGAACAAGAAGAACACACCGTT
GATGTTCAAGTCTGGGAAGAGCTTCACCACGTACGTC