Description :
From Genome Similarity Track
Location :
contig_69:16522- 19282
Sequence
2760 bases(100 bases per row)
TCCGCTTGGGTGCGCCGTGCCATGGACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGTCTAGCCGGCACCCAGCCTCTGGCAGAGCATTG
GTGAGTCATGACCCCACCTCTGCCAGAACACACGGTATCCGAAAGGATTACCTGGACGCAATGGCGTCCGCCGACTTAAGGAAGTCGTCGGAGTAGTTGC
AGCTGCAACAAGTGTTGAGATACCGTCCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAAAGTCCAGCGAGAGGAGCTGCAACGC
CAGCAGCACCCACCGCTCCTGATCGTGACGCCATACAGGTCTCGACTGTATCGGCGCCAGGGGATGTAAGTCTCCCCAGTAGAACAAGTCCACGTGAGGC
CAAGACGGTCGAGACCGTGGCCAGGGCTGAGGTTTCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCCACGGAGTCGATGAGACTCCCGACTCTGCCCT
TGAGTCACCACCGGCCGTGGGTAACGAAGAACCACGCCGGGGTAGGCAATGACGACGTCGTCGCCGCCGTAAACCGAGTCTGTTGAAACAGACTGGAGTC
GCCACGAGCGACTCGGAGTAATCAACGCTCCTCAGGCACGGCCGGCTGAAGATGCTATCACATCTTCGACCGCGAGACCTGTCAGGTCAAGGCGGCGGTC
ATAAGTTTGACCGCCCTGCCGGAGGTGTCAGAGTTTTGACACGAGACTGAGTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGATATGTG
CTGATATTTGATTGGCTACTGAAATTTTGAGTACTGGTTATGCGCATTGCGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCGCTCAG
GCTTTAAGATCCCCCCCCAGATTTGGAAGGTCAGATTAGGCTCCAAACAGCCTGAAACTGGATCTATGTCTGAATAACCCCGTCCTTAAGCGGGTTAACC
CAATGGAGTTGAAAATGCCTATGTGAATGTATCACATATGGTGTCCCGCCTTGCCTAAAGCCTGAGCGTGTGAATGTCCGTGTACCCGGAGTGCACCGTA
AGCACCAGACGCCAGACAAACAAAAAGCCCGTTGAAGAAATGCCGTCTGGACACTCACAATGAAGTATGATTTTGGTCATGAGACCTTGATCACATTAGA
TGTCTGAACGCAGATGTCTGAACGCGGATGTCTGAACGCGGATGTCTGAACGCATGTATTATACGTGCTCAAGACTACCCGGTGCTGTGAGGTCGTACAC
ACTGGTTTCAGCTAAATGTCCAAGTTGAAGAACCCTGAGCGTGAGTTCGAAGTATCTACGTTCAAGAAATTGGAACCTGAAAATGATGTTCAAGGTCAAG
TAACTTGAAAGTAGGTTTAAAGAACCCACGTTCAGACAACCCAGAACCCAATGCGACGATTTGACTCCTTGAAGATGGAAAGTGAACCCACGAAGTGACA
GCCAGTATACTCAAGTCAAGTCAAAGTCAGAAGGTCGCCAGGAAGAACACAGAAGAACACAGAAGAACGAAGACAGACAGATACCCTTTACGAAGAAGCT
AGCGATCGGCTAGCAAAGATAACAATCAGAGTTCGTTTAACCACCTACTACGCAAGTCGCTCAAAGTAAGTCTTCTGACAAGCAGGACACGGGTCCGCCG
TTCAGTTAAGGGCAGTTCGGTGCGGGGCTCTCTACAAGATTCAAGCCCAGTTGCGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCT
TTATTAGTTGGACCCGCTGCGCGTACGGTAAGGGCGGGGTTTTCATTTCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATT
TGATAGACTGCGTTTGAGATAGGATTGTATTGGTGTGTATTATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTAT
CCTGGATCAGCCTTAGTTGACTGGTGTTCAGACCCACCGTTCAAGGGTCTATAAGAATAAGTAACGGCTGCGTGTTGTATATAACTCTGTATTTGTATTG
GGTATCTGAAAGTGGTGTTTGTTCCGAGTTCTCGATACCGGTTCCAGACATTGGAGAAGTGCGTTCAGGAAGTGGACGTTACGCTCAGCATTTCAAGGCC
TATTTGTATTTAACAACTCATTGTGGTGATATATCCGGGCTTCCCCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTGAATCAC
GGTTTCAAGGAACCGCGTTCAGGGTTTACACCCCCCAGGCTTAAGTTTCAGGACTAGTCTAGGCTACCGCTATACCCTTGGGCGAGAAAGTTTCATCGAC
TTCGTCACAGTTTCCCTTTAGGGAATGTCACTGCACGACTTCCTGGTCAGCCTGAAGGCTGAGGAGATGGTACTCCTGTAACCGGAGACCTCTCCTGAAG
AGTTGAACTCTTCTTCTGTTATGGACAGGAACGTCCTGGAAGAATTCTGTTGACGCAGTTACGCATAACTACGTCAACAGGTCGCAAGACCGTGTCCATC
GCGGGTACCCTCGCGGACCGCCAAAGGCTTAGCGGATGGACAGGGCGTCTTGCCCGGCATGTGTGGCTGCGCTATACCACAGCGGTCATCGCCGAGAAGT
CGTCGCGCCGTACGGCCTTCGACTTCAGTAGTGCCGTGTGGCACTACCGGACCGGTGGTT