Description :
From Genome Similarity Track
Location :
Scaffold_792:16520- 17841
Transcript NameFunction/comments
Phyta_totarag10738hypothetical protein

Sequence
1321 bases(100 bases per row)
CTACGGAACAGGCTCATTGTGTCTTGTGCGAGAAGTACTGCTTGAATGCCTGCTTCACCAGTGCTTGGATGCTGCGCGGATCtttcttggtctcctcctg
cttgtggTACGCGATACAGTGAAAACTGCACTTGTTGTTTGCCTTAGGGAAGTTGAGCACATTCTTGTTGTCGCGGATAACCTTAGAGATGAATGTTTCC
CTATCCCCCACCGCGTGGTCGCGGTGGGagatgaagatcttgaaTCCGGTGATTGCCTTGACCATGTACCCAGAGCTTCGATAGTTGAGCTTGTCAGCCA
ACTCCATGGAGCGAATCTCCGAGATGACCTTCTTACGGATATCAGCCTTACTATTGATAGCTACAGGCGAGCTGAACACCGATGTATTGCTCAGATTCGA
ATGGAAGTAGCGCGGTTCGCTATCGTCGGTTCTGCTGACCAGATCATATCCAAGTGCGATGTTAATCTTGAAGGCAGACTTCTGACTCGCGAGTACGTTC
TCNAGCTCGCATGCAAACATGTTGCCTATATATGCTTGACTATATTATTCTCGTAGAATTGACTTTATAATATTCGGATCTTGTATCAGGACCTCGACTT
TATATCTTAGTCGTCTACAAAACAATCTGAAATTAATTCATTCAAATATTCAGCATGAGACCTGTTGCGTGTTTGCAGCCAACGATAATATTTTGGATCA
TTAATCTTGACCCATGCGAATGACATCATAGTAGTTGTCTTTGCCACCAAATAGTGTTCTTGGAAGCAGATTACGTGCTAAATCCTGTTTAGAGGCTTCA
TCACACTTAGGATATACGAGCCATCGACCCCTAATAAAAATTCAGACTTTCGATTTCTGTATTTCTTACCAAAACGTTGCCTCTCTTCACTAAATGAAGT
CAATCCACGGTCTCGACAGTCCTTACAGCACTCATAGCTACCTCGGTACCGACGTCGGCAGCCGAGACACACCTTGTACTGCCCCCCAAAGAGCGTAACA
CAATAAAGTGATGGTTCTCATCCTTATCGATGATTAGGTAGTGTCGCTTGATTGGGGTATTGCAATAGCACCTCGGATGAACATTGGGGCGATAGCCTGG
GCATGGATAAATGTGCGTCTTACCCGTAGGCATCCATTTTCCATTGCCCTCTAACGAGTTCCAGTACCACCCATATGAGTGATATTGAGACAGGTCTCCA
AGTGCTTCGGTCAAAAGCTGAAGCGTGGTGTTATAATAGTTATCGTCTATGTAGGACTTGACTTTTTATCTGACATTTATTTTTATAGTTAAGTTCGGTT
TCCTCGTTAAGTTCGCTTTCG