Description :
From Genome Similarity Track
Location :
scaffold_1268:1652- 3157
Transcript NameFunction/comments
Pl_100951Amino Acid/Auxin Permease (AAAP) Family

Sequence
1505 bases(100 bases per row)
CAACCCGACCGACTCTACTTCATCATGGCGCGCTCTGCTGTCTTCACGATGGAAGACGCCAAGGCGGCCTTCAACCTTTTCTGCTGCGTCTACGGCATTG
GAACGCTTGGTATGCCCGGTAACTTCTCCCGTGCCGGTCCCGTGATCGCAGTTATCGCCATGGCCTTCATGGCCTTTGCCAATACGTACTCCTCCGTCGC
TATTTGCCGCGTCATGCTCCTCGCTCCGCGATCGGTCAAGACATACGGCGACCTCGGTGAATGGTGCATGGGTAAGCCTGGCCGATACCTCTCAGTCATT
TCGCAGATGGGCAATTGTTTGCTGGTGCCTTGTGTGTTCCTCGTGCTTGGTGGTACCCTCCTTGATGGCCTCTTTCCGGAAGCCTTTAGCGCCTCCACGT
GGATTATCCTCATGGCACTTGCTTGTTTGCCTGTGTGCTTGATCCCCACACTCAAGGAAGGTGCTGGTGCTGCCTTTGCGGGCTGTTTGGGCACCCTTAT
TGCTGATATCATTGGTGTTGCCGTCGTGATGCACGGCATGCGTGGTCACCCAAGTGTGCCCAAGCCCGACATTACTTTCAAGCAAGTGGCTGGTGCTTTC
GGCAATTTAGCTCTCGCATACGGTGCCGGTATCGTGATCCCGGCGCTTCAGCGTCAGCACAGTGACCCTACGCGCATGCCCCGCGTCGTAGGAGTCACGA
TGTCGTTCATTTCATGTTGTTTCTTGGTTCTCGCAAGCACAGCGTACTCATCTGTCGGCTGTCAGATTTCGGGTAATCTACTGTGGTCGATTTACCCGGA
CTCAACGAGCGGCTTGACCACGCTAGGTTTTGCATCGGACTGGGGTATGGTTGTTCTCGCCTACCTCTTCATGCAGCTCCACATTACGATCGCCTTCTCG
GTTATCCTGAACCCGGCTTTCTACATTGCTGAGCGCATCGTACTTGGTATGCACAAGCCTGCTGTCGCTGATGTCGAGAACAACTTGTTGAACTACGCCG
ACGCTGCTACTCCTGTTGATGGTGCTGAGCGCTCAGAGAAAGAATCCCGCGCTTCCAAGCGCTCGTTCATTTCTGTCGCTGATAACGAGAATGTACACCT
TGGTGAACCGGATGCTGAGGCTGCTGAATACCGTGGCGCTAACACTATCAAGTACGTCATTCTTCGTATTGTGATTATCATCATCCTCGTTATCGCGGCG
GTCGTCCTCAAAGATCACTTCTCGGACCTGGCAGACTTTGTCGGCGCCTCATGCATCACGGTGAACTCGATCCTTTTGCCGATTGTGTTCCTCTTGAAGA
AGAAGTGGAGCGTGCTTCCCATGTGGGAGAAAATCCCGGCCCTGACTGTTGTCGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACGTACACCTCGGGCAA
GAACCTGTTCGCTCCCAGCGACGATGATGCAGACTTCCCGTTCTGCGCACCGGAGTACGAGAACACCGTGTACTACAACTATACGGCTGAGCATGAGAGT
TAGGC