Description :
From Genome Similarity Track
Location :
Scaffold_573:1652- 2977
Transcript NameFunction/comments
Phyke_g10404hypothetical protein PHYSODRAFT_320136

Sequence
1325 bases(100 bases per row)
AAGTATGGGATCTCGCCGTGCGGCGTCACACGAACAGCGTGTCTGTTGCCCGGGAGGTAGTCAAACGTCGCGTAGTGGAACGTCGCGCGGTTGTCCCAAA
TGGCGACGGCGTTCTTCGTCCAGCGGAAGCGCACCTGGAACTCGTGGCCTTCGGCAACGTGTTGGTACAGGATTTTGAGCACCGCGTCTGCCATTACGCA
ATTACAACAAGCAGACAATACATGTGAGATGACAACTGCATAGATCGACAAACCAAGTAGTGTGTGCTCTAGCTAAGGAAAGAGTGAATTCGTACCGGAC
TCGGCAGAAGAGAGCTGCACGATACGTCTGGTAAACGCAGGGTTCACGTAGAGAGCCTTCCGTCCCGTGACTGGGTGGGTGCGAACCACTGGGTGTTCGA
ACTCAACCGGCGGACGGCGAATCACCTGGCCCTTtgcggcggcagcagcagcctgaGGCTATGGAGACGCAAAACAGTAATAACCAAGAGAGGGTAAAAC
GCAGTCAGCTTCCAGTGTACCATGAGGTATCGGTACAAACGATAGTGCTCTGGACTCACCTTGCCCGTGTGGATCGCCGTGAGGCTTTCAATGAACTTCC
TGAATGGAGGCGTCAAGCGCTCGTAAGCTTCGTAGCCAGAGGCCCAGAGCGTGTCGCCGCCCAAAGGAGGGTTCGTCAACACCTTGAAGCTCGTGTACGA
CGGAGGCTGCAACCAACCAAACAACCAATGAACCAACCGACATAGTTAGCAATTGACTTGAATACTCGCATCAATCTCTACACAAACAATCACCAACTCA
ACTCACCTGACGCTCGTTCGACACATCGCTGTGCCACGCATTGAACGGGTCGTATATTTGTCGCTTCAGAAACCCCTCGCTCGTCTCTACCGAGTTCTCC
ACCACTAGCACCTCATGGTGACCTTCCGGGTGGCCCAAATTCTGGTGTACGTGCAGAGGTCCGTAGTATCGTCCtagctccagctgctgttcaATGTTGA
TCTCCTGGTCACGGAAGAACACGACGCCGCGCTCTGCAATTAGTAGCGCCAGCTCGTCTCTCTGAGGGTCCGTGAGCTCATGCAGTTGGATGCCCGACAG
TTCCGTGCCGATCTTCGGGGCCAGGTGCGTCACGGTGGCATTGGTCAGTAGGTTCTTGAAGGTTGGGTCGGCCTTCAGAGCGCGGTCCTCTACTGGGAGC
ACAGGGATGGGGTCGTACTTGGTCTCCGGATAGGCACTCAGTAGTTCCGGGTGTTCGAACTCCGAGTGTTTCACCTCCTGGTTCAGGGCGTTCTTCGCAG
CAATGGGGGCCGGGACAGTCGCATT