Description :
From Genome Similarity Track
Location :
Scaffold_1607:1652- 2975
Transcript NameFunction/comments
Phymu_g13469hypothetical protein PHYSODRAFT_341850

Sequence
1323 bases(100 bases per row)
CTACACTTCCTCATGCGACTGCATCACACCGAACCGGTTACGGTTCACGTGATTCCGCAAGAACGTACTCAGTATTGCTCCACAATTGAGATCTGCCTCG
TCGAACCAGGTCGGTTCTTCATAACCCACCCAATGTACCAAGAATTATCGGTAGATCCGACCGTAACGAGTTCTTTTCCCACTTCGCATGTCTGAGATCC
GCTCaacttcgtactcgtcggcTTCCAGATCTGGCACCCAACTGTCTTCTGGAAGCAAGATCTCATCAAAATCGAGCCGATCCGTCTCATCAACAGTCAG
ATCGACGCGTGGTCGATCTGGAAAATCCcgcaccagcttcaactttgagACGTGGACCACGGGGAATATCTGGTACCCTGTTCCTgcgatctcgagcttg
atcGTGAActcgttgatcttctccgcgACTCGGAATGGGCCGTGCCAGAGGTGAGCCAGTTTATGGGCATAACCTTCTCTCACTCGATCGAGATACAGCC
AGACTCGGGATCCCACCTCGATCTGATGCGGATCGGCGTGTTCGTTGTGTCGATCAGCTCGATCCGAGATGGCGTCCCGTAATCTGGCATTGACCTGTGC
TCTGGACAGCTGATAGTATCTCTGGATCCGATAACGCCACTTACGCGAGTCTCGATCTTGACGTCTAGTAGATCCGATCGGGATCGTCGCTTCCAACGTA
GATCGCGGATCCCATCCATGTACCAAGTAGTGAGGTGTATCTCCTCGTACCCGATCATGGGCTGTATTGATCGCGAATGTCAATCGTTCAGCGTACTCGT
CCCAATCCTTCTGATCCAGGTCTTGGACGTACATCTTGATCGCCCTGGTCGTCGTCTGCACCATTCGCTCAGCAGTTCCATTAGCTTGGGGTCGATATGC
CATTGTTGCTCGCTGCCGTTGCCCTAGGATCCGATTGaacgacttgaagaagtcggacATAAATCCTGGCTCTCGGTCGTGCCGGATCATCTCGCTTGCC
CCGAATCGACGGAACACACATTCTTCGTAGGACTCGGCGATCGTCTGCGCGGATCGGGAGGAACTGGCCTTCGCGATCACGTATCCCGTGANATATAGGC
CCCTCCAGTGGAAACGACCTCGGATCCGCTGATAAGTGCGACCAATTACCTGGTGACCTCCTTCCAAGGTGGTGTGATAGTGATGCAGGATATCTCGCTG
GAGAGTTTCGGGTACGACCAATCTCGTCAATCCATCTCGATCGTCGTTTGATCTCGTCGTAGGGGGACAGTAGAAGAGTAGATCATGTTCGTCCACCTCG
TAATCTGCAGCGATCTTGCCGTA